View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21293_high_27 (Length: 241)
Name: NF21293_high_27
Description: NF21293
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21293_high_27 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 132; Significance: 1e-68; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 132; E-Value: 1e-68
Query Start/End: Original strand, 37 - 224
Target Start/End: Original strand, 2113859 - 2114033
Alignment:
| Q |
37 |
taagtgagaatgttgtcattgcttaggagatgtttcacactattgagtataactaaaattagagatgaaattccctattttataatcaaagttactctag |
136 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||| |||| | |
|
|
| T |
2113859 |
taagtgagaatgttgtcattgcttaggagatgtttcacactattgagtatgactaaaattagagatgaaattccctattttataatcaaagttgctctgg |
2113958 |
T |
 |
| Q |
137 |
cttaagtgtaagatcgcatcaaatattattttatgtatagaaatgacccttctattttgcatcttgtgtttgaaaatgatgtccttct |
224 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2113959 |
cttaagtgtaagatcgcatcaaatatt-------------aaatgacccttctattttgcatcttgtgtttgaaaatgatgtccttct |
2114033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 30; E-Value: 0.00000008
Query Start/End: Original strand, 1 - 34
Target Start/End: Original strand, 2112751 - 2112784
Alignment:
| Q |
1 |
ctccttgtcaaactgattttgtatccaagataaa |
34 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||| |
|
|
| T |
2112751 |
ctccatgtcaaactgattttgtatccaagataaa |
2112784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University