View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21293_high_28 (Length: 241)
Name: NF21293_high_28
Description: NF21293
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21293_high_28 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 229
Target Start/End: Complemental strand, 34899301 - 34899073
Alignment:
| Q |
1 |
ccatgtattgagtgaaggcctcatccgttaagggagactcaggtagggaaattcctcagaaacattgcatgtaccgaaacacagttgtgggctggacagg |
100 |
Q |
| |
|
|||||| |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||| |
|
|
| T |
34899301 |
ccatgtcttgagttaaggcctcatccgttaagggagactcaggtagggaaattcctcagaaacattgcatgtaccgaaacacagctgtgggctggacagg |
34899202 |
T |
|
| Q |
101 |
aaagtggggtgagggtgtgggagtttcaaaaggcctatgaacacggttgcggtctgggaggaagggttaggaggggagatgaggacgctgcgccttttta |
200 |
Q |
| |
|
|| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
34899201 |
aatgtggggtgagggtgtgggagtttcaaaaggcctatgaacacggttgcggtctgggaggaagggttaggaggggagatgaggacgctgcaccttttta |
34899102 |
T |
|
| Q |
201 |
tgaatctgctgatacctctcctacatttt |
229 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
34899101 |
tgaatctgctgatacctctcctacatttt |
34899073 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University