View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21293_high_30 (Length: 239)

Name: NF21293_high_30
Description: NF21293
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21293_high_30
NF21293_high_30
[»] chr3 (1 HSPs)
chr3 (18-239)||(54115165-54115386)


Alignment Details
Target: chr3 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 18 - 239
Target Start/End: Original strand, 54115165 - 54115386
Alignment:
18 attgaatgttcaggactgagacttggtaatttgtactgtgatccactgatgatggcttgctctggacacaagataacttcgaggcagcgttggactccaa 117  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
54115165 attgaatgttcaggactgagacttggtaatttgtactgtgatccactgatgatggcttgctctggacacaagataacttcgaggcagcgttggactccaa 54115264  T
118 tgcctatccagcttcaaatactcgagcgtattttcgatgaaggcaatggcactcccaccaaacagaagatcaaagacataaccattgaactagggcaaca 217  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
54115265 tgcctatccagcttcaaatactcgagcgtattttcgatgaaggcaatggcactcccaccaaacagaagatcaaagacataaccattgaactagggcaaca 54115364  T
218 cggtcaaatatccgagactaat 239  Q
    ||||||||||||||||||||||    
54115365 cggtcaaatatccgagactaat 54115386  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University