View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21293_low_23 (Length: 295)
Name: NF21293_low_23
Description: NF21293
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21293_low_23 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 105; Significance: 2e-52; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 105; E-Value: 2e-52
Query Start/End: Original strand, 132 - 276
Target Start/End: Original strand, 16737230 - 16737374
Alignment:
| Q |
132 |
gaaatggattctatgaactatcattttcaaacttggaggttgttaggagagttcattccattggttcttggaatctaaactgtggatttatgaatatctt |
231 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |||||||||||| ||||||||||||||||||| |
|
|
| T |
16737230 |
gaaaaggattctatgaactatcattttcaaacttggaggttgttaggagagttcatttcattggttcgtggaatctaaaccgtggatttatgaatatctt |
16737329 |
T |
|
| Q |
232 |
cgtgtggatcggagatttcaattcgttattgcaacaaagaaccta |
276 |
Q |
| |
|
|||||||| ||||||| |||| |||||||||||||||||||| |
|
|
| T |
16737330 |
tgtgtggattagagattttaattaattattgcaacaaagaaccta |
16737374 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 73; E-Value: 2e-33
Query Start/End: Original strand, 10 - 114
Target Start/End: Original strand, 16737057 - 16737161
Alignment:
| Q |
10 |
aagaatatgagtatcttggtggttttgatgcatgcaaacacaaccttcatccaaggatcgtttggtcaaaagatgcaatccacattagaaggatttgtta |
109 |
Q |
| |
|
|||| ||||||||||| ||||||||| |||||||||||||||| |||||| |||||||| |||||||||| |||||||||||||||||||| |||||||| |
|
|
| T |
16737057 |
aagagtatgagtatctaggtggttttcatgcatgcaaacacaatcttcatgcaaggatcatttggtcaaaggatgcaatccacattagaagaatttgtta |
16737156 |
T |
|
| Q |
110 |
aagtg |
114 |
Q |
| |
|
||||| |
|
|
| T |
16737157 |
aagtg |
16737161 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University