View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21294_high_13 (Length: 367)
Name: NF21294_high_13
Description: NF21294
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21294_high_13 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 298; Significance: 1e-167; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 298; E-Value: 1e-167
Query Start/End: Original strand, 11 - 349
Target Start/End: Complemental strand, 38052371 - 38052033
Alignment:
| Q |
11 |
aatatcataatcactaggttgtatgctttttaatataattaaatcccaatttaaagagcaccaaaacatcaacttacagagatttaaacaatttgttatg |
110 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38052371 |
aatatcataatcactaggttgtatgctttttaatataattaaatcccaatttaaagagcaccaaaacatcaacttacagagatttaaacaatttgttatg |
38052272 |
T |
 |
| Q |
111 |
gtttgtattttagtttcagactctatcaaaaagtttgatggaactatgtttaaaatccggcggttttggagatactttttagagaaaggttttgttgaac |
210 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
38052271 |
gtttgtattttagtttcagactctatcaaaaagtttgatggaactatgtttaaaatccggcagttttggagatactttttagagaaagattttgttgaac |
38052172 |
T |
 |
| Q |
211 |
cnnnnnnngaagaaaatttcaagagtttgaagtttagggcaattctggagcaatataatagaagtttagttttagttttgtaatatgaattgattttttc |
310 |
Q |
| |
|
| |||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||| ||| |
|
|
| T |
38052171 |
caaaaaaagaagaaaatttcaagagtttgaagtttagggcaattctagagcaatataatagaagtttagttttagttttgtaatatgaattgatttcttc |
38052072 |
T |
 |
| Q |
311 |
atcgagaagactcttctccatctacaacggacaataaga |
349 |
Q |
| |
|
||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
38052071 |
atcgagaagactcttctccatctacaacgaacaataaga |
38052033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 29; E-Value: 0.0000005
Query Start/End: Original strand, 141 - 204
Target Start/End: Original strand, 40254061 - 40254122
Alignment:
| Q |
141 |
aagtttgatggaactatgtttaaaatccggcggttttggagatactttttagagaaaggttttg |
204 |
Q |
| |
|
||||||||| ||||||||||||||| || | |||| |||||||| ||||||||||| |||||| |
|
|
| T |
40254061 |
aagtttgatcgaactatgtttaaaacccagtggttatggagata--ttttagagaaaagttttg |
40254122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University