View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21294_high_22 (Length: 239)
Name: NF21294_high_22
Description: NF21294
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21294_high_22 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 199; Significance: 1e-108; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 199; E-Value: 1e-108
Query Start/End: Original strand, 11 - 217
Target Start/End: Original strand, 12320032 - 12320238
Alignment:
| Q |
11 |
cgaagaatatgagatcgtgattgttggaggtggtatatgtggccttgcaacagccctagcacttcataggttttattattatgcaagccaaatttattta |
110 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12320032 |
cgaagaaaatgagatcgtgattgttggaggtggtatatgtggccttgcaacagccctagcacttcataggttttattattatgcaagccaaatttattta |
12320131 |
T |
 |
| Q |
111 |
tatataaaactttgatatgatcttataagataagattacattttcactaactttgcaggaagagaataaagagtttggtgttagaaagatcagaggagtt |
210 |
Q |
| |
|
||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12320132 |
tatataaaactttgatatgatattataagataagattacattttcactaactttgcaggaagagaataaagagtttggtgttagaaagatcagaggagtt |
12320231 |
T |
 |
| Q |
211 |
gagagct |
217 |
Q |
| |
|
||||||| |
|
|
| T |
12320232 |
gagagct |
12320238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 89; E-Value: 5e-43
Query Start/End: Original strand, 100 - 216
Target Start/End: Original strand, 12311971 - 12312087
Alignment:
| Q |
100 |
aaatttatttatatataaaactttgatatgatcttataagataagattacattttcactaactttgcaggaagagaataaagagtttggtgttagaaaga |
199 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||| ||||||||||| ||||||| ||||||||||||||||| |||||||||||||||||||||| | |
|
|
| T |
12311971 |
aaatttatttatatataaaactttgatatgatcttatgagataagattatattttcattaactttgcaggaagagtataaagagtttggtgttagaaaaa |
12312070 |
T |
 |
| Q |
200 |
tcagaggagttgagagc |
216 |
Q |
| |
|
|||||||| ||| |||| |
|
|
| T |
12312071 |
tcagaggaattgcgagc |
12312087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 64; E-Value: 4e-28
Query Start/End: Original strand, 14 - 107
Target Start/End: Original strand, 12311705 - 12311795
Alignment:
| Q |
14 |
agaatatgagatcgtgattgttggaggtggtatatgtggccttgcaacagccctagcacttcataggttttattattatgcaagccaaatttat |
107 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||| |||| ||||||| ||||||||| |
|
|
| T |
12311705 |
agaaaatgagatcgtgattgttggaggtggtatatgtggccttgcaacagccctagcgcttcataggttctatt---atgcaagtcaaatttat |
12311795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University