View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21294_low_20 (Length: 316)
Name: NF21294_low_20
Description: NF21294
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21294_low_20 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 267; Significance: 1e-149; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 267; E-Value: 1e-149
Query Start/End: Original strand, 15 - 295
Target Start/End: Complemental strand, 52118499 - 52118222
Alignment:
| Q |
15 |
catcacattatagcttaagccaaggaccacaacaccagctaattatgcatgcataattaacatacatgtatatgtgtatggttcctttggtattttgtac |
114 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52118499 |
catcacattatagcttaagccaaggaccacaacaccagctaattatgcatgcat---taacatacatgtatatgtgtatggttcctttggtattttgtac |
52118403 |
T |
 |
| Q |
115 |
atcaaagacaggtccacacttaaacaacttgacatacgcatgctctacgaatttatatataataattattagtttggaatgtggaaattattgaaataat |
214 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52118402 |
atcaaagacaggtccacacttaaacaacttgacatacgcatgctctacgaatttatatataataattattagtttggaatgtggaaattattgaaataat |
52118303 |
T |
 |
| Q |
215 |
aatggatcaagtatgcaagaattccatgcaattcgaatttagccataaataattaacttgataattggttggtacgtacag |
295 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
52118302 |
aatggatcaagtatgcaagaattccatgcaattcgaatttagccataaataattaacttgataattggttggtacgtacag |
52118222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University