View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21294_low_24 (Length: 248)
Name: NF21294_low_24
Description: NF21294
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21294_low_24 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 203; Significance: 1e-111; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 203; E-Value: 1e-111
Query Start/End: Original strand, 26 - 228
Target Start/End: Complemental strand, 47003225 - 47003023
Alignment:
| Q |
26 |
tgcccttgtttatatggtcagctaaccatccttgtccatctctagtcccagttactttcttcacaactgacacaaggaaactgctgacgaagaaaccgag |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47003225 |
tgcccttgtttatatggtcagctaaccatccttgtccatctctagtcccagttactttcttcacaactgacacaaggaaactgctgacgaagaaaccgag |
47003126 |
T |
 |
| Q |
126 |
ggataaagttgttaggaagagaccagtgctcattgttttcattccttttggtgattgtgttatgaagaaatcaagttgtcctgtgtatatgaatgcttca |
225 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
47003125 |
ggataaagttgttaggaagagaccagtgctcattgttttcattccttttggtgattgtgttatgaagaaatcaagttgtcctgtgtatatgaatgcttca |
47003026 |
T |
 |
| Q |
226 |
cca |
228 |
Q |
| |
|
||| |
|
|
| T |
47003025 |
cca |
47003023 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University