View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21295_high_7 (Length: 227)
Name: NF21295_high_7
Description: NF21295
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21295_high_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 197; Significance: 1e-107; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 197; E-Value: 1e-107
Query Start/End: Original strand, 1 - 213
Target Start/End: Complemental strand, 41980246 - 41980035
Alignment:
| Q |
1 |
gtagataggaagcacatcattcatgtcggttaaccctggacgtaagaattttgtacattataatatatcattaaacacctttcccataataatgcatata |
100 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41980246 |
gtagataggaagcacatcattcatatcggttaaccctggacgtaacaattttgtacattataatatatcattaaacacctttcccataataatgcatata |
41980147 |
T |
 |
| Q |
101 |
ataagaggaaaaaagagaggttcttatataccgagagattcaagtaaaaattcaacagcttttcccttgttccagtcaattacaggacggatttctaaaa |
200 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41980146 |
ataagaggaaaaaa-agaggttcttatataccgagagattcaagtaaaaattcaacagcttttcccttgttccagtcaattacaggacggatttctaaaa |
41980048 |
T |
 |
| Q |
201 |
cctatcacaacac |
213 |
Q |
| |
|
||||||||||||| |
|
|
| T |
41980047 |
cctatcacaacac |
41980035 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University