View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21295_low_10 (Length: 203)
Name: NF21295_low_10
Description: NF21295
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21295_low_10 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 143; Significance: 3e-75; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 143; E-Value: 3e-75
Query Start/End: Original strand, 16 - 179
Target Start/End: Original strand, 41110224 - 41110387
Alignment:
| Q |
16 |
agcatagggtccaatctaactaacgatgatgtgttgttaaagagtactgtattttagcgtacaaaataataccgtatttcagaaagaaggaaaaaatacg |
115 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41110224 |
agcatagggtccaatctaactaacgatgatgtgttgttaaagagtactgtattttagcgtacaaaataataccgtatttcagaaagaaggaaaaaatacg |
41110323 |
T |
 |
| Q |
116 |
gtattttnnnnnnnttacttataaatactttggttctagatatttcgatagggctggctgtatg |
179 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
41110324 |
gtattttaaaaaaattacttataaatactttggttctagatatttcgatagggctggctgtatg |
41110387 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University