View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21297_high_24 (Length: 244)
Name: NF21297_high_24
Description: NF21297
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21297_high_24 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 134; Significance: 7e-70; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 134; E-Value: 7e-70
Query Start/End: Original strand, 1 - 142
Target Start/End: Complemental strand, 10586741 - 10586600
Alignment:
| Q |
1 |
ccctgagtttcctggtagaactgtcacattggagcctgctcatggagaaatttgtgtaagtctttcaattttttaattatcaagttccataaggacttgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10586741 |
ccctgagtttcctggtagaactgtcacattggagcctgctcaaggagaaatttgtgtaagtctttcaattttttaattatcaagttccataaggacttgt |
10586642 |
T |
 |
| Q |
101 |
ttgggtgagcaacttgattaagaaaagtgattttgatgttca |
142 |
Q |
| |
|
|||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
10586641 |
ttgggtgaccaacttgattaagaaaagtgattttgatgttca |
10586600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 47; E-Value: 6e-18
Query Start/End: Original strand, 169 - 224
Target Start/End: Complemental strand, 10586588 - 10586531
Alignment:
| Q |
169 |
gagaaagttgtt--gtgtttgtttatcaaaatgaaaattactttaaaaactcagttat |
224 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10586588 |
gagaaagttgttttgtgtttgtttatcaaaatgaaaattactttaaaaactcagttat |
10586531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University