View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21297_high_9 (Length: 355)
Name: NF21297_high_9
Description: NF21297
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21297_high_9 |
 | |
|
Alignment Details
Target: chr5 (Bit Score: 144; Significance: 1e-75; HSPs: 1)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 144; E-Value: 1e-75
Query Start/End: Original strand, 148 - 291
Target Start/End: Complemental strand, 38759167 - 38759024
Alignment:
| Q |
148 |
ttaatatttataaaagtggcggtgggaggttgtgtggcacacaatgctggcacgaggcggagctcggacaaccttacaatggtctacatagagttccatc |
247 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38759167 |
ttaatatttataaaagtggcggtgggaggttgtgtggcacacaatgctggcacgaggcggagctcggacaaccttacaatggtctacatagagttccatc |
38759068 |
T |
|
| Q |
248 |
aacccacaacggtccatgaaagaggtggcttcgaacttgcggta |
291 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38759067 |
aacccacaacggtccatgaaagaggtggcttcgaacttgcggta |
38759024 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University