View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21297_low_16 (Length: 310)
Name: NF21297_low_16
Description: NF21297
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21297_low_16 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 268; Significance: 1e-149; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 268; E-Value: 1e-149
Query Start/End: Original strand, 21 - 300
Target Start/End: Complemental strand, 2891972 - 2891693
Alignment:
| Q |
21 |
tactaccacattcactaccccttgtgtttcttcattgccaaatgtggatacatatacatcaaatttcaccgaccttagtaattaccaacaatattctgtt |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2891972 |
tactaccacattcactaccccttgtgtttcttcattgccaaatgtggatacatatacatcaaatttcaccgaccttagtaattaccaacaatattctgtt |
2891873 |
T |
 |
| Q |
121 |
catgatattgattgccaccaaaataatgggtttggtctaagtaccttaaaagaggaggattatatccctcaattatcaaactataataattattatggtt |
220 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
2891872 |
catgatattgattgccaccaaaataatgggtttggtctaagtaacttaaaagaggaggattatatccctcaattatcaaactataataattattatggtt |
2891773 |
T |
 |
| Q |
221 |
ctgataatcaaaatcttatttactatcaaacttcaaatcaacttctatcaacaccatcatcttctagtcccacacctttg |
300 |
Q |
| |
|
||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||| |
|
|
| T |
2891772 |
ctgataatcaaaatcttatgtactatcaaacttcaaatcaacttctatcaacaccgtcatcttctagtcccacacctttg |
2891693 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University