View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21297_low_17 (Length: 302)
Name: NF21297_low_17
Description: NF21297
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21297_low_17 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 142; Significance: 2e-74; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 142; E-Value: 2e-74
Query Start/End: Original strand, 97 - 238
Target Start/End: Original strand, 13168276 - 13168417
Alignment:
| Q |
97 |
cattagtatgtctaagacaatattatatgtatgtgaccaagaaagactcgtttatcatccatctcaaccatgctcacctatcctcaaatgcaatagaaaa |
196 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13168276 |
cattagtatgtctaagacaatattatatgtatgtgaccaagaaagactcgtttatcatccatctcaaccatgctcacctatcctcaaatgcaatagaaaa |
13168375 |
T |
 |
| Q |
197 |
tcatcttagattgtggacgaagttaacttttactgtgctggt |
238 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
13168376 |
tcatcttagattgtggacgaagttaacttttactgtgctggt |
13168417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 87; E-Value: 1e-41
Query Start/End: Original strand, 197 - 287
Target Start/End: Original strand, 13168417 - 13168507
Alignment:
| Q |
197 |
tcatcttagattgtggacgaagttaacttttactgtgctggttgtcacttgtcactcacttcactgtcatccagcatacacgtgcaacata |
287 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
13168417 |
tcatcttagattgtggacgaagttaacttttactgtgctggttgtcacttgtcactcacttcactgtcatccggcatacacgtgcaacata |
13168507 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 1 - 33
Target Start/End: Original strand, 13168186 - 13168218
Alignment:
| Q |
1 |
tttctcacacactcacaaaatctttattctacc |
33 |
Q |
| |
|
||||||||||||||||||||| ||||||||||| |
|
|
| T |
13168186 |
tttctcacacactcacaaaatatttattctacc |
13168218 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University