View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21297_low_22 (Length: 250)
Name: NF21297_low_22
Description: NF21297
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21297_low_22 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 182; Significance: 2e-98; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 182; E-Value: 2e-98
Query Start/End: Original strand, 21 - 238
Target Start/End: Original strand, 51495609 - 51495826
Alignment:
| Q |
21 |
agtgctacagaggatcaacttatcacaccatggaatttctctgttgctaggtacgtacatatctcatcctaattacgtcacaatacatctgaaaaaatat |
120 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51495609 |
agtgctacagaggatcaacttatcacaccatggaatttctctgttgctaggtacgtccatatctcatcctaattacgtcacaatacatctgaaaaaatat |
51495708 |
T |
|
| Q |
121 |
gcaacatcttacgaactaattatggtaactagctaacataaacannnnnnnnatgtatagtttctctgtacaatgtgcaatttggatctatgccctgttt |
220 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51495709 |
gcaacaacttacgaactaattatggtaactagctagcataaacattttttttatgtatagtttctctgtacaatgtgcaatttggatctatgccctgttt |
51495808 |
T |
|
| Q |
221 |
gtttgttttgacgatatt |
238 |
Q |
| |
|
|||||||||||||||||| |
|
|
| T |
51495809 |
gtttgttttgacgatatt |
51495826 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University