View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21297_low_29 (Length: 238)
Name: NF21297_low_29
Description: NF21297
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21297_low_29 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 3 - 219
Target Start/End: Original strand, 10586886 - 10587098
Alignment:
| Q |
3 |
aatctttgatgaaaccaacaacacgttcatcgaagttaaaaccagcttttgagatcaaagaaccgtaaccaaatacccatattgccatgtttatgttgtt |
102 |
Q |
| |
|
||||||||||||||||||||| |||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10586886 |
aatctttgatgaaaccaacaagacgttcatcgtagttaaaaccagcttttgagatcaaagaaccgtaaccaaatacccatattgccatgtttatgttgtt |
10586985 |
T |
 |
| Q |
103 |
taaggttttcagttttctggttatggatggaactcagaaaatgaccaatcacttggaaaatgcagtcactcactcattggcaaatttatttcagcacaaa |
202 |
Q |
| |
|
|||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10586986 |
taaggttttcagttttctggtt----atggaactcagaaaatgaccaatcacttggaaaatgcagtcactcactcattggcaaatttatttcagcacaaa |
10587081 |
T |
 |
| Q |
203 |
tgttttgtttttataac |
219 |
Q |
| |
|
||||||||||||||||| |
|
|
| T |
10587082 |
tgttttgtttttataac |
10587098 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University