View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21297_low_29 (Length: 238)

Name: NF21297_low_29
Description: NF21297
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21297_low_29
NF21297_low_29
[»] chr1 (1 HSPs)
chr1 (3-219)||(10586886-10587098)


Alignment Details
Target: chr1 (Bit Score: 192; Significance: 1e-104; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 192; E-Value: 1e-104
Query Start/End: Original strand, 3 - 219
Target Start/End: Original strand, 10586886 - 10587098
Alignment:
3 aatctttgatgaaaccaacaacacgttcatcgaagttaaaaccagcttttgagatcaaagaaccgtaaccaaatacccatattgccatgtttatgttgtt 102  Q
    ||||||||||||||||||||| |||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10586886 aatctttgatgaaaccaacaagacgttcatcgtagttaaaaccagcttttgagatcaaagaaccgtaaccaaatacccatattgccatgtttatgttgtt 10586985  T
103 taaggttttcagttttctggttatggatggaactcagaaaatgaccaatcacttggaaaatgcagtcactcactcattggcaaatttatttcagcacaaa 202  Q
    ||||||||||||||||||||||    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
10586986 taaggttttcagttttctggtt----atggaactcagaaaatgaccaatcacttggaaaatgcagtcactcactcattggcaaatttatttcagcacaaa 10587081  T
203 tgttttgtttttataac 219  Q
    |||||||||||||||||    
10587082 tgttttgtttttataac 10587098  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University