View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21298_high_12 (Length: 266)
Name: NF21298_high_12
Description: NF21298
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21298_high_12 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 107; Significance: 1e-53; HSPs: 2)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 107; E-Value: 1e-53
Query Start/End: Original strand, 129 - 259
Target Start/End: Original strand, 10253903 - 10254033
Alignment:
| Q |
129 |
aggttttatttaccttttagccgaactctaaattatcatgacccctttctcataaaaattgaaggtacaacacataatataaaataaaatacttcatctc |
228 |
Q |
| |
|
|||||||||||||||||||||||||||| ||||||||||||||| ||||||||||||||||||||||||||||| |||||||||||||||||||| |||| |
|
|
| T |
10253903 |
aggttttatttaccttttagccgaactccaaattatcatgacccatttctcataaaaattgaaggtacaacacagaatataaaataaaatacttcctctc |
10254002 |
T |
|
| Q |
229 |
caataaaggtatctgaacctaatttcttatc |
259 |
Q |
| |
|
|||||||| ||||||||||||||||||||| |
|
|
| T |
10254003 |
caataaagacatctgaacctaatttcttatc |
10254033 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 31; E-Value: 0.00000002
Query Start/End: Original strand, 18 - 48
Target Start/End: Original strand, 10253792 - 10253822
Alignment:
| Q |
18 |
cacaaaaaataattcaagtcagcctaatcac |
48 |
Q |
| |
|
||||||||||||||||||||||||||||||| |
|
|
| T |
10253792 |
cacaaaaaataattcaagtcagcctaatcac |
10253822 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 132 - 172
Target Start/End: Complemental strand, 25481543 - 25481503
Alignment:
| Q |
132 |
ttttatttaccttttagccgaactctaaattatcatgaccc |
172 |
Q |
| |
|
||||||||| |||||||||||||| || ||||||||||||| |
|
|
| T |
25481543 |
ttttatttatcttttagccgaactttagattatcatgaccc |
25481503 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University