View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21298_high_16 (Length: 244)
Name: NF21298_high_16
Description: NF21298
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21298_high_16 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 138; Significance: 3e-72; HSPs: 2)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 138; E-Value: 3e-72
Query Start/End: Original strand, 77 - 226
Target Start/End: Complemental strand, 45142892 - 45142743
Alignment:
| Q |
77 |
ttagagtttcaaacaatttccaagcatttgttttttgtagaccgtgttaaacacttttccactctagaagctggatgaaactataaacacgagaagttga |
176 |
Q |
| |
|
||||||| ||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
45142892 |
ttagagtatcaaacaatttccaagcatttgtttgttgtagaccgtgttaaacacttttccactctagaagccggatgaaactataaacacgagaagttga |
45142793 |
T |
 |
| Q |
177 |
aatactcactaataggatctcgaaatgggccacaagaaccattctcaatc |
226 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45142792 |
aatactcactaataggatctcgaaatgggccacaagaaccattctcaatc |
45142743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 15 - 80
Target Start/End: Complemental strand, 45142992 - 45142927
Alignment:
| Q |
15 |
accacagataagacagtcatttaatcagtgttaattcaaaaataaacaagagaaaatgaatattag |
80 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45142992 |
accacagataagacagtcatttaatcagtgttaattcaaaaataaacaagagaaaatgaatattag |
45142927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University