View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21298_high_8 (Length: 303)
Name: NF21298_high_8
Description: NF21298
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21298_high_8 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 102; Significance: 1e-50; HSPs: 3)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 102; E-Value: 1e-50
Query Start/End: Original strand, 96 - 209
Target Start/End: Original strand, 53303361 - 53303474
Alignment:
| Q |
96 |
gtagcctcagaagagaaaaataaatcaagccatacaaatatacaatgtatacttatttagtgagtaactaaaatacgatgtgtctaactaaaataaacat |
195 |
Q |
| |
|
||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||| |
|
|
| T |
53303361 |
gtagcctcagaagagaaaaataaatcatgccatacaaatatacaatgtatacttatttagtgagtaactaaaatacgatatctctaactaaaataaacat |
53303460 |
T |
|
| Q |
196 |
tgcttgtaaattgt |
209 |
Q |
| |
|
|||||||||||||| |
|
|
| T |
53303461 |
tgcttgtaaattgt |
53303474 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 92; E-Value: 1e-44
Query Start/End: Original strand, 1 - 100
Target Start/End: Original strand, 53300231 - 53300330
Alignment:
| Q |
1 |
aactcgaacttctactactactcatagagaacgccaggacaaattctaaaatttgaacactgtctaattttagccgattccaaacagaactactagtagc |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
53300231 |
aactcgaacttctactactactcatagagaacgcaaggacaaattctaagatttgaacactgtctaattttagccgattccaaacagaactactagtagc |
53300330 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 80; E-Value: 2e-37
Query Start/End: Original strand, 203 - 290
Target Start/End: Original strand, 53304248 - 53304335
Alignment:
| Q |
203 |
aaattgtttagtgagttctagttaagcttttacaagcatcatttatagcactttgatgtggttctcttatccaaaattggttaggttc |
290 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
53304248 |
aaattatttagtgagttctagttaagcttttacaagcatcatttatagcactttgatgtggttctcttatccaaaattgtttaggttc |
53304335 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University