View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21298_low_16 (Length: 256)
Name: NF21298_low_16
Description: NF21298
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21298_low_16 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 172; Significance: 2e-92; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 172; E-Value: 2e-92
Query Start/End: Original strand, 1 - 242
Target Start/End: Original strand, 54734286 - 54734531
Alignment:
| Q |
1 |
tcatattagcatttagcactctactttttcctaacacacccctgcaagttcatgtat--ctattatctata----caataatatttaaaggaaataaaag |
94 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
54734286 |
tcatattagcatttagcactctactttttcctaacacacccctgcaagttcatgtatatctattatctatatatacaataatatttaaaggaaataaaag |
54734385 |
T |
 |
| Q |
95 |
atttttaacttccttnnnnnnnntaaaagattttgaactatctttttcattaatgataatttgttattcagaagaattgcaattgcaaagacgagaccgc |
194 |
Q |
| |
|
||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
54734386 |
attttggacttccttaaaaaaa--aaaagattttgaactatctttttcattaatgataatttgttattcagaagaattgcaattgcaaagacgagaccgc |
54734483 |
T |
 |
| Q |
195 |
acaagactggtttgcttattgccagtcaagttttgcatgatctgtgct |
242 |
Q |
| |
|
||||||||||||||||||||| ||||| |||||||||||||||||||| |
|
|
| T |
54734484 |
acaagactggtttgcttattggcagtctagttttgcatgatctgtgct |
54734531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University