View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21298_low_8 (Length: 324)
Name: NF21298_low_8
Description: NF21298
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21298_low_8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 98; Significance: 3e-48; HSPs: 2)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 42600022 - 42600119
Alignment:
| Q |
1 |
ggtctgtaggaatacccaaaacttgaattttcccacatagattcatagacaaagccattaacaactttcaatttagtcttctaaatacataaaaccca |
98 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
42600022 |
ggtctgtaggaatacccaaaacttgaattttcccacatagattcatagacaaagccattaacaactttcaatttagtcttctaaatacataaaaccca |
42600119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 287 - 320
Target Start/End: Complemental strand, 42600483 - 42600450
Alignment:
| Q |
287 |
agagagatgaatgaagccttaaatatcacaatag |
320 |
Q |
| |
|
|||||||||||||| ||||||||||||||||||| |
|
|
| T |
42600483 |
agagagatgaatgatgccttaaatatcacaatag |
42600450 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University