View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21298_low_8 (Length: 324)

Name: NF21298_low_8
Description: NF21298
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21298_low_8
NF21298_low_8
[»] chr5 (2 HSPs)
chr5 (1-98)||(42600022-42600119)
chr5 (287-320)||(42600450-42600483)


Alignment Details
Target: chr5 (Bit Score: 98; Significance: 3e-48; HSPs: 2)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 98; E-Value: 3e-48
Query Start/End: Original strand, 1 - 98
Target Start/End: Original strand, 42600022 - 42600119
Alignment:
1 ggtctgtaggaatacccaaaacttgaattttcccacatagattcatagacaaagccattaacaactttcaatttagtcttctaaatacataaaaccca 98  Q
    ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
42600022 ggtctgtaggaatacccaaaacttgaattttcccacatagattcatagacaaagccattaacaactttcaatttagtcttctaaatacataaaaccca 42600119  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 287 - 320
Target Start/End: Complemental strand, 42600483 - 42600450
Alignment:
287 agagagatgaatgaagccttaaatatcacaatag 320  Q
    |||||||||||||| |||||||||||||||||||    
42600483 agagagatgaatgatgccttaaatatcacaatag 42600450  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University