View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2129_high_8 (Length: 281)

Name: NF2129_high_8
Description: NF2129
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2129_high_8
NF2129_high_8
[»] chr2 (1 HSPs)
chr2 (17-199)||(32348234-32348419)


Alignment Details
Target: chr2 (Bit Score: 160; Significance: 3e-85; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 160; E-Value: 3e-85
Query Start/End: Original strand, 17 - 199
Target Start/End: Complemental strand, 32348419 - 32348234
Alignment:
17 gatacttatttacgtggacaagttgatataaacttttgttctgattttaattgaaccctcgttagtggttgacaaaatttgtctttcaattgaattggtt 116  Q
    |||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
32348419 gatacttatttacgtggacaagttgatataaaattttgttctgattttaattgaaccctcgttagtggttgacaaaatttgtctttcaattgaattggtt 32348320  T
117 attcgacccaatattgaatttttagaaaatcaatttaaaattattggctaagct---tcataatcgtttttctcatcaccgtctaa 199  Q
    ||||||| ||||||||||||||||||||||||||||||||||||||||||||||   |||||||| ||||||||||||||||||||    
32348319 attcgactcaatattgaatttttagaaaatcaatttaaaattattggctaagctacatcataatcatttttctcatcaccgtctaa 32348234  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University