View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2129_low_11 (Length: 281)
Name: NF2129_low_11
Description: NF2129
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2129_low_11 |
 | |
|
Alignment Details
Target: chr2 (Bit Score: 160; Significance: 3e-85; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 160; E-Value: 3e-85
Query Start/End: Original strand, 17 - 199
Target Start/End: Complemental strand, 32348419 - 32348234
Alignment:
| Q |
17 |
gatacttatttacgtggacaagttgatataaacttttgttctgattttaattgaaccctcgttagtggttgacaaaatttgtctttcaattgaattggtt |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
32348419 |
gatacttatttacgtggacaagttgatataaaattttgttctgattttaattgaaccctcgttagtggttgacaaaatttgtctttcaattgaattggtt |
32348320 |
T |
|
| Q |
117 |
attcgacccaatattgaatttttagaaaatcaatttaaaattattggctaagct---tcataatcgtttttctcatcaccgtctaa |
199 |
Q |
| |
|
||||||| |||||||||||||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||| |
|
|
| T |
32348319 |
attcgactcaatattgaatttttagaaaatcaatttaaaattattggctaagctacatcataatcatttttctcatcaccgtctaa |
32348234 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University