View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2129_low_18 (Length: 202)
Name: NF2129_low_18
Description: NF2129
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2129_low_18 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 15 - 192
Target Start/End: Original strand, 14430879 - 14431056
Alignment:
| Q |
15 |
ctggtggataaccaccgggttgagctggtgggtagccaccataagcagccgctgccggtggtgcaggtggatatccataacccggttgttgaggctgagg |
114 |
Q |
| |
|
|||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||| |
|
|
| T |
14430879 |
ctggtggataaccaccaggttgagccggtgggtagccaccataagcagccgctgccggtggtgcaggtggatatccataacccggttgttgcggctgagg |
14430978 |
T |
 |
| Q |
115 |
aggataaggtgtaccatacggcaccgagctagaccccgctgccgccattccaggtggaggataagccatcacaggttc |
192 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| ||||| |
|
|
| T |
14430979 |
aggataaggtgtaccatacggcaccgagctagacccagctgccgccattccaggtggaggataagccatcaccggttc |
14431056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University