View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF2129_low_18 (Length: 202)

Name: NF2129_low_18
Description: NF2129
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF2129_low_18
NF2129_low_18
[»] chr2 (1 HSPs)
chr2 (15-192)||(14430879-14431056)


Alignment Details
Target: chr2 (Bit Score: 158; Significance: 3e-84; HSPs: 1)
Name: chr2
Description:

Target: chr2; HSP #1
Raw Score: 158; E-Value: 3e-84
Query Start/End: Original strand, 15 - 192
Target Start/End: Original strand, 14430879 - 14431056
Alignment:
15 ctggtggataaccaccgggttgagctggtgggtagccaccataagcagccgctgccggtggtgcaggtggatatccataacccggttgttgaggctgagg 114  Q
    |||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||    
14430879 ctggtggataaccaccaggttgagccggtgggtagccaccataagcagccgctgccggtggtgcaggtggatatccataacccggttgttgcggctgagg 14430978  T
115 aggataaggtgtaccatacggcaccgagctagaccccgctgccgccattccaggtggaggataagccatcacaggttc 192  Q
    |||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||| |||||    
14430979 aggataaggtgtaccatacggcaccgagctagacccagctgccgccattccaggtggaggataagccatcaccggttc 14431056  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University