View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21300_high_2 (Length: 419)
Name: NF21300_high_2
Description: NF21300
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21300_high_2 |
 |  |
|
Alignment Details
Target: chr8 (Bit Score: 349; Significance: 0; HSPs: 1)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 349; E-Value: 0
Query Start/End: Original strand, 1 - 390
Target Start/End: Original strand, 38096500 - 38096884
Alignment:
| Q |
1 |
aaagcagcaggaagggaggctgagcaatgtggggaccacaagcaaaagaagggagagtgttgatgaagagaaagtgtattctggtgatgaagatatatgt |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||| |||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38096500 |
aaagcagcaggaagggaggctgagcaatgtggggacaacaagcaagagaagggagagtgttgatgaagagaaagtgtattctggtgatgaagatatatgt |
38096599 |
T |
 |
| Q |
101 |
gtaacggagaatccaaggttgatggggaatttgcagagtgaagagaaggaatactttagtgggagtattgtggaatccatgaaagcaaaccgggttgctt |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38096600 |
gtaacggagaatccaaggttgatggggaatttgcagagtgaagagaaggaatactttagtgggagtattgtggaatccatgaaagcaaaccgggttgctt |
38096699 |
T |
 |
| Q |
201 |
ttcaagctgaacctgtgctcaagaaatctaattcctataatgaagaaaggtacgtttctcattaattacttatagaatttcttttatttgttgtttaatt |
300 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||| |||||||||||||||||||||||||| |
|
|
| T |
38096700 |
ttcaagctgaacctgtgctcaagaaatctaattcctataatgaagaaaggtacgtttctc----attacttttagaatttcttttatttgttgtttaa-a |
38096794 |
T |
 |
| Q |
301 |
tgttaccttttgttttcttacaggagaagcaggctagggatggatgaggtgaagttaaaggaaacaaaagaggaaaagagggaggcaaaa |
390 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38096795 |
tgttaccttttgttttcttacaggagaagcaggctagggatggatgaggtgaagttaaaggaaacaaaagaggaaaagagggaggcaaaa |
38096884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University