View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21300_low_3 (Length: 421)
Name: NF21300_low_3
Description: NF21300
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21300_low_3 |
 | |
|
Alignment Details
Target: chr8 (Bit Score: 109; Significance: 1e-54; HSPs: 3)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 109; E-Value: 1e-54
Query Start/End: Original strand, 17 - 125
Target Start/End: Complemental strand, 38097355 - 38097247
Alignment:
| Q |
17 |
aagaagtttgtgccaaagcaggagtactatcattagtttgtcgcctagtgaatacaacctctaagttgttgcaattagataaatgactctaagtagagtc |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38097355 |
aagaagtttgtgccaaagcaggagtactatcattagtttgtcgcctagtgaatacaacctctaagttgttgcaattagataaatgactctaagtagagtc |
38097256 |
T |
|
| Q |
117 |
atcaataat |
125 |
Q |
| |
|
||||||||| |
|
|
| T |
38097255 |
atcaataat |
38097247 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 101; E-Value: 6e-50
Query Start/End: Original strand, 172 - 299
Target Start/End: Complemental strand, 38097152 - 38097020
Alignment:
| Q |
172 |
aggcttgcattaaggtcacaaatgcactttactaaataagatga-----aatcgagatttgaagagaaattaatattacatgcatcaacctataattgct |
266 |
Q |
| |
|
|||||||||||||||||| ||||||||||||||||||||||||| ||||| |||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
38097152 |
aggcttgcattaaggtcagaaatgcactttactaaataagatgagatgaaatcgggatttgaaaagaaattaatattacatgcatcaacctataattgct |
38097053 |
T |
|
| Q |
267 |
agtgtactcattacatattctacctagactaga |
299 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
38097052 |
agtgtactcattacatattctacctagactaga |
38097020 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 74; E-Value: 8e-34
Query Start/End: Original strand, 320 - 397
Target Start/End: Complemental strand, 38096967 - 38096890
Alignment:
| Q |
320 |
gaccagaccagaccagatcaccatcatttcctactctctttggatgatttcataagcggtatgcatttctctttcact |
397 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38096967 |
gaccagaccataccagatcaccatcatttcctactctctttggatgatttcataagcggtatgcatttctctttcact |
38096890 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University