View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21300_low_8 (Length: 221)
Name: NF21300_low_8
Description: NF21300
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21300_low_8 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 183; Significance: 4e-99; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 183; E-Value: 4e-99
Query Start/End: Original strand, 17 - 203
Target Start/End: Complemental strand, 3209243 - 3209057
Alignment:
| Q |
17 |
aaggctatagaagagaatgaggaggttctatcaactcggctggagaaaatgtattcattacacacaactcacacttcaagcttcttggggttacaacaaa |
116 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3209243 |
aaggctctagaagagaatgaggaggttctatcaactcggctggagaaaatgtattcattacacacaactcacacttcaagcttcttggggttacaacaaa |
3209144 |
T |
 |
| Q |
117 |
atcaagacttgtggggaaattccaatcaaggtaaagggatcataattggaatcgtcgacacaggaataaccctctcacatccttcct |
203 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3209143 |
atcaagacttgtggggaaattccaatcaaggtaaagggatcataattggaatcgtcgacacaggaataaccctctcacatccttcct |
3209057 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 112; E-Value: 9e-57
Query Start/End: Original strand, 24 - 203
Target Start/End: Complemental strand, 3203262 - 3203083
Alignment:
| Q |
24 |
tagaagagaatgaggaggttctatcaactcggctggagaaaatgtattcattacacacaactcacacttcaagcttcttggggttacaacaaaatcaaga |
123 |
Q |
| |
|
|||||||||||||||||||||| |||| ||| | || || || | ||||||||||||||||||||| |||||||||||||||| ||||| |||||||| |
|
|
| T |
3203262 |
tagaagagaatgaggaggttctgtcaattcgaccagaaaagattttctcattacacacaactcacactccaagcttcttggggttgcaacagaatcaaga |
3203163 |
T |
 |
| Q |
124 |
cttgtggggaaattccaatcaaggtaaagggatcataattggaatcgtcgacacaggaataaccctctcacatccttcct |
203 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||| | ||||||||||||||||||||||||||||||| |
|
|
| T |
3203162 |
attgtggggaaattccaatcaaggtaaagggatcataattggaatgctggacacaggaataaccctctcacatccttcct |
3203083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 17 - 203
Target Start/End: Complemental strand, 3217191 - 3217005
Alignment:
| Q |
17 |
aaggctatagaagagaatgaggaggttctatcaactcggctggagaaaatgtattcattacacacaactcacacttcaagcttcttggggttacaacaaa |
116 |
Q |
| |
|
|||||| |||||||||| |||||||||||||||| ||| | || || || |||||||| ||||||||||| |||||||||||||||| ||||| | |
|
|
| T |
3217191 |
aaggctctagaagagaaggaggaggttctatcaattcgaccagaaaacatcctctcattacatacaactcacacaccaagcttcttggggttgcaacaga |
3217092 |
T |
 |
| Q |
117 |
atcaagacttgtggggaaattccaatcaaggtaaagggatcataattggaatcgtcgacacaggaataaccctctcacatccttcct |
203 |
Q |
| |
|
||||| || ||| ||||||||||| |||||||||||||||||||||||| | |||||||||||| ||||||| |||||||||| |
|
|
| T |
3217091 |
gtcaaggattatggataaattccaatctcggtaaagggatcataattggaatcctggacacaggaatatccctctcccatccttcct |
3217005 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University