View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21301_low_10 (Length: 215)
Name: NF21301_low_10
Description: NF21301
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21301_low_10 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 189; Significance: 1e-103; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 189; E-Value: 1e-103
Query Start/End: Original strand, 1 - 197
Target Start/End: Original strand, 25016172 - 25016368
Alignment:
| Q |
1 |
aatggcagggaagagaatggacagcttggtaccaagaataacctcttggatgttaaccaacacgttccggagcgaagcacatcgaatcctcgacacaaga |
100 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
25016172 |
aatggcagggaagagaatggacagcttggtaccaagaataacctcttggatgttaaccaaaacgttccggagcgaagcacatcgaatccttgacacaaga |
25016271 |
T |
|
| Q |
101 |
gcgtgatcagatttcttgcgcaaggaagaagaagacatgccatgcgcggtccggctccggccatgtccatgtctagcttccttggtcaagacctttg |
197 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
25016272 |
gcgtgatcagatttcttgcgcaaggaagaagaagacatgccatgcgcggtccggctccggccatgtccatgtctagcttccttggtcaagacctttg |
25016368 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University