View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21302_high_6 (Length: 342)
Name: NF21302_high_6
Description: NF21302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21302_high_6 |
 | |
|
Alignment Details
Target: chr4 (Bit Score: 176; Significance: 9e-95; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 176; E-Value: 9e-95
Query Start/End: Original strand, 109 - 324
Target Start/End: Original strand, 51822034 - 51822252
Alignment:
| Q |
109 |
ccctcgaagagagggtgaggaagacaagacagacaatagaaagag--gaagatgatacggaattgttgttaggggggaactgtttcagggtcagactttc |
206 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||| ||||||||||| ||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
51822034 |
ccctcgaagagagggtgaggaagaaaagacagacaatagaaagagaggaagatgatacagaattgttgttaggggggaactgtttcagggtcagactttc |
51822133 |
T |
|
| Q |
207 |
cctttaatacacttacaaccctccaaacttaatttaatcaaaatcaa-gataaacaaggaaaacgatgttattgtcgggaccacaattagactttcagcc |
305 |
Q |
| |
|
||||||||||||| || |||||||||||||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||| ||||||||||| |
|
|
| T |
51822134 |
cctttaatacactcactaccctccaaacttaatttaatcaaaatcaaggataaacacggaaaacgatgttattgtcgggaccacaattggactttcagcc |
51822233 |
T |
|
| Q |
306 |
caaactacatattgggctt |
324 |
Q |
| |
|
||||||||||||||||||| |
|
|
| T |
51822234 |
caaactacatattgggctt |
51822252 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University