View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21302_low_18 (Length: 240)
Name: NF21302_low_18
Description: NF21302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21302_low_18 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 209; Significance: 1e-114; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 209; E-Value: 1e-114
Query Start/End: Original strand, 1 - 221
Target Start/End: Original strand, 46141151 - 46141370
Alignment:
| Q |
1 |
tcaaatatggttaggtcactgttccatcttattttctttcttgcagaagattattttaaaggaagaatattcgtataactgagatgtggtgaggttaggt |
100 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||| |
|
|
| T |
46141151 |
tcaaatatggttaggtcactgttccatcttattttctttcttgcagaagattattttaaaggaagaatattcgtataactgagatgtggtgaggt-aggt |
46141249 |
T |
|
| Q |
101 |
taggtatacaattatctgttagcgcccacaaatagttacatacgcacacgacttttttagcagtgttttggtctattaagatttaagatatactagctga |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||| |
|
|
| T |
46141250 |
taggtatacaattatctgttagcgcccacaaatagttacatacgcacacgacttttttagcaatgttttggtctattaagatttaagatatactagctga |
46141349 |
T |
|
| Q |
201 |
caaaatcatgtgcgagtgcgt |
221 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
46141350 |
caaaatcatgtgcgagtgcgt |
46141370 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University