View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21302_low_19 (Length: 238)
Name: NF21302_low_19
Description: NF21302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21302_low_19 |
 |  |
|
| [»] chr1 (2 HSPs) |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 125; Significance: 2e-64; HSPs: 2)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 125; E-Value: 2e-64
Query Start/End: Original strand, 106 - 238
Target Start/End: Complemental strand, 31801563 - 31801431
Alignment:
| Q |
106 |
aaaccagtaattagggtttgtgattgcgaggacccaacaagcaacaatcaggaatcaaaattccaatcaagaaagaagaacagagcctctgtctgtctct |
205 |
Q |
| |
|
|||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31801563 |
aaaccagtaattagggtttgtgattggcaggacccaacaagcaacaatcaggaatcaaaattccaatcaagaaagaagaacagagcctctgtctgtctct |
31801464 |
T |
 |
| Q |
206 |
gctgctttctaggtattctcttcaatccatgtt |
238 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
31801463 |
gctgctttctaggtattctcttcaatccatgtt |
31801431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 33
Target Start/End: Complemental strand, 31801594 - 31801562
Alignment:
| Q |
1 |
attctgggcattatgatgaaatatttgggtgaa |
33 |
Q |
| |
|
|||||||||||||||||||||||||| |||||| |
|
|
| T |
31801594 |
attctgggcattatgatgaaatattttggtgaa |
31801562 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University