View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21302_low_20 (Length: 236)
Name: NF21302_low_20
Description: NF21302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21302_low_20 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 152; Significance: 1e-80; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 152; E-Value: 1e-80
Query Start/End: Original strand, 70 - 221
Target Start/End: Complemental strand, 31801130 - 31800979
Alignment:
| Q |
70 |
gtgttaattaacagggttttgtgtttatacactatgaagagaacaatgccatggagtgatgatgatgactcatctaatgatgagtcatcttctttgcatt |
169 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31801130 |
gtgttaattaacagggttttgtgtttatacactatgaagagaacaatgccatggagtgatgatgatgactcatctaatgatgagtcatcttctttgcatt |
31801031 |
T |
|
| Q |
170 |
cagactctgaaaatgatagtaaaactggagccaaaaaatccaaaggtatttt |
221 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
31801030 |
cagactctgaaaatgatagtaaaactggagccaaaaaatccaaaggtatttt |
31800979 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University