View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21302_low_6 (Length: 402)
Name: NF21302_low_6
Description: NF21302
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21302_low_6 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 344; Significance: 0; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 344; E-Value: 0
Query Start/End: Original strand, 18 - 393
Target Start/End: Complemental strand, 17327859 - 17327484
Alignment:
| Q |
18 |
gttttgacttttactcataactttgttattcttcttgttatgcttaagggccctaaaaatccttggttcaaggtttatttgctttctgtggctactttgg |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
17327859 |
gttttgacttttactcataactttgttattcttcttgttatgcttaagggtcctaaaaatccttggttgaaggtttatttgctttctgtggctactttgg |
17327760 |
T |
 |
| Q |
118 |
ttttggttataattggttctggttatactggaccttctatgaaccctgctaatgcatttggttgggcttatatgaacaataagcacaatacttgggagca |
217 |
Q |
| |
|
|||||||||| || |||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17327759 |
ttttggttattataggttctggctacactggaccttctatgaaccctgctaatgcatttggttgggcttatatgaacaataagcacaatacttgggagca |
17327660 |
T |
 |
| Q |
218 |
attttatgttttttggatatgtcctttaattggtgctagttctgctgctatggtttatcggtttctatttatgtcaccagttaaggagaagaaagcttga |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
17327659 |
attttatgttttttggatatgtcctttaattggtgctagttctgctgctatggtttatcggtttctatttatgtcaccagttaaggagaagaaagcttga |
17327560 |
T |
 |
| Q |
318 |
gtcgagggacttagttctaaattgcggtccacaatcataattatgggcgtatcataaaggttttagaggtctctgc |
393 |
Q |
| |
|
|||||||||||| ||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||| |
|
|
| T |
17327559 |
gtcgagggactttgttctaaattgcggtccacaatcataattatgggcgtatcataaaagttttagaggtctctgc |
17327484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University