View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21303_high_13 (Length: 262)

Name: NF21303_high_13
Description: NF21303
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21303_high_13
NF21303_high_13
[»] chr1 (1 HSPs)
chr1 (122-244)||(5780537-5780665)
[»] chr3 (1 HSPs)
chr3 (17-63)||(14076684-14076730)


Alignment Details
Target: chr1 (Bit Score: 62; Significance: 7e-27; HSPs: 1)
Name: chr1
Description:

Target: chr1; HSP #1
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 122 - 244
Target Start/End: Complemental strand, 5780665 - 5780537
Alignment:
122 ctgttaatgccacagctgatgggtttacaaatagttctggtggcaatggagaaaca------cccacacgaacgaatccttgcattgctcgctcaattag 215  Q
    ||||||||||  ||||||||||||||||||||||||||||||||||||| |    |      |||||||||||| |||||||||| ||||||||| ||||    
5780665 ctgttaatgcttcagctgatgggtttacaaatagttctggtggcaatggtggtggagggcttcccacacgaacggatccttgcatggctcgctcagttag 5780566  T
216 tgtacatggaagctctcagatgcagggtc 244  Q
    |||||||||| ||||||||||||||||||    
5780565 tgtacatggatgctctcagatgcagggtc 5780537  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr3 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: chr3
Description:

Target: chr3; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 17 - 63
Target Start/End: Complemental strand, 14076730 - 14076684
Alignment:
17 tgaagagcatgggaagaaatggtgaagccactcgccatattatgata 63  Q
    |||||||||||||||||||||||||||||||| ||||||||||||||    
14076730 tgaagagcatgggaagaaatggtgaagccacttgccatattatgata 14076684  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University