View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21303_low_13 (Length: 262)
Name: NF21303_low_13
Description: NF21303
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21303_low_13 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 62; Significance: 7e-27; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 62; E-Value: 7e-27
Query Start/End: Original strand, 122 - 244
Target Start/End: Complemental strand, 5780665 - 5780537
Alignment:
| Q |
122 |
ctgttaatgccacagctgatgggtttacaaatagttctggtggcaatggagaaaca------cccacacgaacgaatccttgcattgctcgctcaattag |
215 |
Q |
| |
|
|||||||||| ||||||||||||||||||||||||||||||||||||| | | |||||||||||| |||||||||| ||||||||| |||| |
|
|
| T |
5780665 |
ctgttaatgcttcagctgatgggtttacaaatagttctggtggcaatggtggtggagggcttcccacacgaacggatccttgcatggctcgctcagttag |
5780566 |
T |
 |
| Q |
216 |
tgtacatggaagctctcagatgcagggtc |
244 |
Q |
| |
|
|||||||||| |||||||||||||||||| |
|
|
| T |
5780565 |
tgtacatggatgctctcagatgcagggtc |
5780537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 17 - 63
Target Start/End: Complemental strand, 14076730 - 14076684
Alignment:
| Q |
17 |
tgaagagcatgggaagaaatggtgaagccactcgccatattatgata |
63 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |||||||||||||| |
|
|
| T |
14076730 |
tgaagagcatgggaagaaatggtgaagccacttgccatattatgata |
14076684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University