View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21305_high_5 (Length: 290)
Name: NF21305_high_5
Description: NF21305
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21305_high_5 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 145; Significance: 2e-76; HSPs: 2)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 145; E-Value: 2e-76
Query Start/End: Original strand, 112 - 285
Target Start/End: Complemental strand, 3308266 - 3308085
Alignment:
| Q |
112 |
tacccaacaaacttcacagcacttaaaaatttacatgataaagccagaaacctcattggtgttgcaacttggtcaccttaatttagtttggacagctcta |
211 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
3308266 |
tacccaacaaacttcacagcacttaaaaatttacatgataaagccagaaacctcattggtgttgcaacttggtcaccttaatttagtttggacagctcta |
3308167 |
T |
|
| Q |
212 |
gctag--------taatgtgcttaattttcttagctggtctctatcacatgttgccatcacatgtacttacctatgcttctc |
285 |
Q |
| |
|
||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||| |
|
|
| T |
3308166 |
gctagcttcaatccaatgtgcttaattttcttagctggtctctatcacatgttgccatcacatgtacttacctattcttctc |
3308085 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 218 - 285
Target Start/End: Complemental strand, 3306491 - 3306425
Alignment:
| Q |
218 |
aatgtgcttaattttcttagctggtctctatcacatgttgccatcacatgtacttacctatgcttctc |
285 |
Q |
| |
|
|||||||||||||| | |||| |||| ||||||||||| |||||| |||||||||||||| |||||| |
|
|
| T |
3306491 |
aatgtgcttaatttcca-agctagtctttatcacatgtttccatcatatgtacttacctattcttctc |
3306425 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University