View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21305_high_8 (Length: 238)
Name: NF21305_high_8
Description: NF21305
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21305_high_8 |
 | |
|
| [»] chr2 (1 HSPs) |
| |
|
Alignment Details
Target: chr2 (Bit Score: 221; Significance: 1e-122; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 221; E-Value: 1e-122
Query Start/End: Original strand, 18 - 238
Target Start/End: Complemental strand, 6865029 - 6864809
Alignment:
| Q |
18 |
tgcaggagttgctaagtttgatcctgcaactggaaaacagttcaagaccaaggctcccacgccggtactcacatcatgctttgtggatgctttgattgca |
117 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6865029 |
tgcaggagttgctaagtttgatcctgcaactggaaaacagttcaagaccaaggctcccacgccggtactcacatcatgctttgtggatgctttgattgca |
6864930 |
T |
|
| Q |
118 |
gaagcagaagctgacaaaggcattgttggaatccatgctgcaatgggaggtggaaccggcatgaatcacttccttcgccgtttccctacgagatgtttcg |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
6864929 |
gaagcagaagctgacaaaggcattgttggaatccatgctgcaatgggaggtggaaccggcatgaatcacttccttcgccgtttccctacgagatgtttcg |
6864830 |
T |
|
| Q |
218 |
atgtagggatagcagaacaac |
238 |
Q |
| |
|
||||||||||||||||||||| |
|
|
| T |
6864829 |
atgtagggatagcagaacaac |
6864809 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 59; Significance: 4e-25; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 59; E-Value: 4e-25
Query Start/End: Original strand, 106 - 236
Target Start/End: Original strand, 49147078 - 49147208
Alignment:
| Q |
106 |
gctttgattgcagaagcagaagctgacaaaggcattgttggaatccatgctgcaatgggaggtggaaccggcatgaatcacttccttcgccgtttcccta |
205 |
Q |
| |
|
||||||||||||||||| |||||||||||| |||| ||| |||||||||||| |||||||||||||| || |||||| ||||| |||||| ||||| | |
|
|
| T |
49147078 |
gctttgattgcagaagccaaagctgacaaagacattattgcaatccatgctgcgatgggaggtggaactgggatgaatatcttccatcgccgattcccaa |
49147177 |
T |
|
| Q |
206 |
cgagatgtttcgatgtagggatagcagaaca |
236 |
Q |
| |
|
| ||||| || || || |||||||||||||| |
|
|
| T |
49147178 |
caagatgctttgacgtggggatagcagaaca |
49147208 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University