View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21305_low_1 (Length: 423)

Name: NF21305_low_1
Description: NF21305
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21305_low_1
NF21305_low_1
[»] chr5 (3 HSPs)
chr5 (16-86)||(12819462-12819532)
chr5 (2-76)||(12820939-12821015)
chr5 (112-162)||(12819689-12819736)


Alignment Details
Target: chr5 (Bit Score: 63; Significance: 3e-27; HSPs: 3)
Name: chr5
Description:

Target: chr5; HSP #1
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 16 - 86
Target Start/End: Original strand, 12819462 - 12819532
Alignment:
16 aataaagtatttagtattttaagaaaattgttgaagaattgattaaattttcttctagactattctagaaa 86  Q
    |||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| |||||||||    
12819462 aataaaatatttagtattttaagaaaattgttgaagaattgattaaattttcttctagactcttctagaaa 12819532  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #2
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 2 - 76
Target Start/End: Original strand, 12820939 - 12821015
Alignment:
2 ataataaaagat--aaaataaagtatttagtattttaagaaaattgttgaagaattgattaaattttcttctagact 76  Q
    ||||||||||||  |||| ||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||    
12820939 ataataaaagattaaaaaaaaagtatttagtattttaagagaattgttgaagaattgattaaattttcttctagact 12821015  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr5; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 112 - 162
Target Start/End: Original strand, 12819689 - 12819736
Alignment:
112 tgtagccgctgaacgaaagtgtagtgatcaagaagatgtagaatcttctag 162  Q
    |||||||||||||||||||||||| ||||   |||||||||||||||||||    
12819689 tgtagccgctgaacgaaagtgtagcgatc---aagatgtagaatcttctag 12819736  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University