View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21305_low_1 (Length: 423)
Name: NF21305_low_1
Description: NF21305
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21305_low_1 |
 |  |
|
Alignment Details
Target: chr5 (Bit Score: 63; Significance: 3e-27; HSPs: 3)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 63; E-Value: 3e-27
Query Start/End: Original strand, 16 - 86
Target Start/End: Original strand, 12819462 - 12819532
Alignment:
| Q |
16 |
aataaagtatttagtattttaagaaaattgttgaagaattgattaaattttcttctagactattctagaaa |
86 |
Q |
| |
|
|||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||| |
|
|
| T |
12819462 |
aataaaatatttagtattttaagaaaattgttgaagaattgattaaattttcttctagactcttctagaaa |
12819532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 58; E-Value: 3e-24
Query Start/End: Original strand, 2 - 76
Target Start/End: Original strand, 12820939 - 12821015
Alignment:
| Q |
2 |
ataataaaagat--aaaataaagtatttagtattttaagaaaattgttgaagaattgattaaattttcttctagact |
76 |
Q |
| |
|
|||||||||||| |||| ||||||||||||||||||||| |||||||||||||||||||||||||||||||||||| |
|
|
| T |
12820939 |
ataataaaagattaaaaaaaaagtatttagtattttaagagaattgttgaagaattgattaaattttcttctagact |
12821015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 112 - 162
Target Start/End: Original strand, 12819689 - 12819736
Alignment:
| Q |
112 |
tgtagccgctgaacgaaagtgtagtgatcaagaagatgtagaatcttctag |
162 |
Q |
| |
|
|||||||||||||||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
12819689 |
tgtagccgctgaacgaaagtgtagcgatc---aagatgtagaatcttctag |
12819736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University