View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21306_high_7 (Length: 272)
Name: NF21306_high_7
Description: NF21306
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21306_high_7 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 222; Significance: 1e-122; HSPs: 1)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 222; E-Value: 1e-122
Query Start/End: Original strand, 20 - 253
Target Start/End: Original strand, 10593738 - 10593971
Alignment:
| Q |
20 |
cgagagtgctatcaacttcccaacacttctcctcccaagcattcctagcaagttccgcctcactagcatccctctcagcagcctgcaactccttcttcat |
119 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10593738 |
cgagagtgctatcaacttcccaacacttctcctcccaagcatttctagcaagttccgcctcactagcatccctctcagcagcctgcaactccttcttcat |
10593837 |
T |
 |
| Q |
120 |
cctatccacatccctggcattaaaagtctgcaactccactttactcttaagctcctcattctcctcaacaatcctctcattctccaccaccttagcctcc |
219 |
Q |
| |
|
|||||||||||| || |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
10593838 |
cctatccacatctctcgcattaaaagtctgcaactccactttactcttaagctcctcattctcctcaacaatcctctcattctccaccaccttagcctcc |
10593937 |
T |
 |
| Q |
220 |
aattgcttctccttctccatcaaaaccctctcca |
253 |
Q |
| |
|
|||||||||||||||||||||||||||||||||| |
|
|
| T |
10593938 |
aattgcttctccttctccatcaaaaccctctcca |
10593971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University