View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21306_low_8 (Length: 250)
Name: NF21306_low_8
Description: NF21306
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21306_low_8 |
 | |
|
Alignment Details
Target: chr7 (Bit Score: 213; Significance: 1e-117; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 213; E-Value: 1e-117
Query Start/End: Original strand, 1 - 245
Target Start/End: Original strand, 11477530 - 11477774
Alignment:
| Q |
1 |
agctaagaagttttttgatttcttgcatcacaaggtcgttgtcatcgacttgtttcagttggattttggagaaaagcatgctttggagacgtgtccagaa |
100 |
Q |
| |
|
||||||| || || |||||||||||||||||| |||||||||||||||||||||||||||||||||||||||| |||||||||||||||||||||||||| |
|
|
| T |
11477530 |
agctaaggagcttcttgatttcttgcatcacacggtcgttgtcatcgacttgtttcagttggattttggagaagagcatgctttggagacgtgtccagaa |
11477629 |
T |
|
| Q |
101 |
gaaccatatcatgctttgttctgaccaactgtgagtgtagagcttttcgcggattatagtgtcgcatactttttgtacttgatctcgcttgttgcttttt |
200 |
Q |
| |
|
||||||||||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
11477630 |
gaaccatatcatgctttgttctgaccagctgtgagtgtagagcttttcgcggattatagtgtcgcatactttttgtacttgatctcgcttgttgcttttt |
11477729 |
T |
|
| Q |
201 |
cctacgtataccatctctagcggtgtacgtgtcgcctatgctact |
245 |
Q |
| |
|
|||||||||||||||||||| |||||||||||||||| ||||||| |
|
|
| T |
11477730 |
cctacgtataccatctctagaggtgtacgtgtcgcctgtgctact |
11477774 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University