View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21307_low_4 (Length: 292)
Name: NF21307_low_4
Description: NF21307
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21307_low_4 |
 |  |
|
| [»] scaffold0308 (1 HSPs) |
 |  |  |
|
| [»] scaffold0039 (1 HSPs) |
 |  |  |
|
| [»] scaffold0008 (1 HSPs) |
 |  |  |
|
| [»] scaffold0036 (1 HSPs) |
 |  |  |
|
| [»] scaffold1086 (1 HSPs) |
 |  |  |
|
| [»] scaffold0178 (2 HSPs) |
 |  |  |
|
| [»] scaffold1990 (1 HSPs) |
 |  |  |
|
| [»] scaffold0092 (1 HSPs) |
 |  |  |
|
| [»] scaffold0809 (1 HSPs) |
 |  |  |
|
| [»] scaffold0119 (1 HSPs) |
 |  |  |
|
| [»] scaffold0334 (1 HSPs) |
 |  |  |
|
| [»] scaffold0191 (1 HSPs) |
 |  |  |
|
| [»] scaffold0112 (1 HSPs) |
 |  |  |
|
| [»] scaffold0002 (2 HSPs) |
 |  |  |
|
| [»] scaffold0219 (1 HSPs) |
 |  |  |
|
| [»] scaffold0168 (1 HSPs) |
 |  |  |
|
| [»] scaffold0009 (2 HSPs) |
 |  |  |
|
| [»] scaffold0006 (1 HSPs) |
 |  |  |
|
| [»] scaffold0118 (1 HSPs) |
 |  |  |
|
| [»] scaffold0070 (1 HSPs) |
 |  |  |
|
| [»] scaffold0343 (1 HSPs) |
 |  |  |
|
| [»] scaffold0088 (1 HSPs) |
 |  |  |
|
| [»] scaffold0054 (1 HSPs) |
 |  |  |
|
| [»] scaffold0765 (1 HSPs) |
 |  |  |
|
| [»] scaffold0533 (1 HSPs) |
 |  |  |
|
| [»] scaffold0062 (1 HSPs) |
 |  |  |
|
| [»] scaffold0059 (1 HSPs) |
 |  |  |
|
| [»] scaffold0126 (2 HSPs) |
 |  |  |
|
| [»] scaffold0019 (1 HSPs) |
 |  |  |
|
| [»] scaffold0001 (1 HSPs) |
 |  |  |
|
| [»] scaffold0690 (1 HSPs) |
 |  |  |
|
| [»] scaffold0366 (1 HSPs) |
 |  |  |
|
| [»] scaffold0102 (1 HSPs) |
 |  |  |
|
| [»] scaffold0027 (1 HSPs) |
 |  |  |
|
| [»] scaffold0024 (2 HSPs) |
 |  |  |
|
| [»] scaffold0117 (1 HSPs) |
 |  |  |
|
| [»] scaffold0044 (1 HSPs) |
 |  |  |
|
| [»] scaffold0043 (1 HSPs) |
 |  |  |
|
| [»] scaffold0519 (1 HSPs) |
 |  |  |
|
| [»] scaffold0154 (1 HSPs) |
 |  |  |
|
| [»] scaffold0021 (1 HSPs) |
 |  |  |
|
| [»] scaffold0687 (1 HSPs) |
 |  |  |
|
| [»] scaffold1343 (1 HSPs) |
 |  |  |
|
| [»] scaffold0246 (1 HSPs) |
 |  |  |
|
| [»] scaffold0010 (1 HSPs) |
 |  |  |
|
Alignment Details
Target: chr4 (Bit Score: 80; Significance: 1e-37; HSPs: 218)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 183 - 278
Target Start/End: Complemental strand, 47018047 - 47017952
Alignment:
| Q |
183 |
tgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||||||||| ||||||||||||| |||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
47018047 |
tgtcccgtgagcatagctcagttggtaggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttattcaccttataag |
47017952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #2
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 184 - 278
Target Start/End: Original strand, 3465578 - 3465672
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||| |||||| ||||||||||||| |||||||||||||||||||||| |||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
3465578 |
gtcccgtaagcataactcagttggtaggacaatgcattattatatgcaggggccggagttcgaaccccggacaccccacttattcaccttataag |
3465672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #3
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 184 - 278
Target Start/End: Complemental strand, 24234174 - 24234080
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||||||| ||||||||||||| |||||||||||||||||||||| |||||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
24234174 |
gtcccgtgagcatagctcagttggtaggtcaatgcattattatatgcaggggccggggtttgaaccccggacaccccacttattcatcttataag |
24234080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #4
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 184 - 278
Target Start/End: Complemental strand, 5430465 - 5430370
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccac-ttattcaccttataag |
278 |
Q |
| |
|
|||||||||||||| ||||||||||||| ||||| ||||||||||||||||||| |||||| ||||||||||||||||| |||||||||||||||| |
|
|
| T |
5430465 |
gtcccgtgagcatagctcagttggtaggacaatgtattattatatgcagggaccagggttcgaaccccggacaccccactttattcaccttataag |
5430370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #5
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 183 - 278
Target Start/End: Complemental strand, 20753226 - 20753131
Alignment:
| Q |
183 |
tgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||||||||| ||||||||||||| |||||||||||||||| |||| ||||||||| ||||||||||||| ||||||||||||||||||| |
|
|
| T |
20753226 |
tgtcccgtgagcatagctcagttggtaggaaaatgcattattatatgtaggggccggggttcgaaccccggacaccacacttattcaccttataag |
20753131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #6
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 186 - 281
Target Start/End: Complemental strand, 28520830 - 28520734
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataagtga |
281 |
Q |
| |
|
|||||||||||| ||||||||| |||| |||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||| ||| |||||| |
|
|
| T |
28520830 |
cccgtgagcatagctcagttggcagggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttattcactttaaaagtga |
28520734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #7
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 187 - 278
Target Start/End: Original strand, 32885686 - 32885777
Alignment:
| Q |
187 |
ccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||||| ||||||||||||| |||||||||||||||||||||| ||| |||| |||| |||||||||||||||||||||||||||| |
|
|
| T |
32885686 |
ccgtgagcatagctcagttggtaggacaatgcattattatatgcaggggtcggagttcgaacctcggacaccccacttattcaccttataag |
32885777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #8
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 184 - 278
Target Start/End: Complemental strand, 548987 - 548893
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||||||| | ||||||||||| |||||||||||||||||||||| ||||||||| || | | |||||||||||||||||||||||||| |
|
|
| T |
548987 |
gtcccgtgagcatagcccagttggtaggacaatgcattattatatgcaggggccggggttcgaaactcagacaccccacttattcaccttataag |
548893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #9
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 184 - 278
Target Start/End: Complemental strand, 9285759 - 9285665
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||||||| |||| |||||||| |||||||||||||||||||||| | ||||||| |||||| ||||||||||||||| |||||||||| |
|
|
| T |
9285759 |
gtcccgtgagcatagctcaattggtaggacaatgcattattatatgcagggtctggggttcgaaccccagacaccccacttattaaccttataag |
9285665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #10
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 180 - 278
Target Start/End: Original strand, 31601797 - 31601895
Alignment:
| Q |
180 |
aaatgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||||||| ||| |||||||||||| ||||| |||||||||||||||| ||| | ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
31601797 |
aaatgtcccgtgagtatagctcagttggtagaacaatgtattattatatgcaggggccgagattcgaaccccggacaccccacttattcaccttataag |
31601895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #11
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 186 - 278
Target Start/End: Original strand, 36008271 - 36008364
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||||| ||||||||| |||| ||||||||| |||||||||||| ||||||||| ||||||| ||||||||||||||||||||||||| |
|
|
| T |
36008271 |
cccgtgagcatagctcagttggcagggacaatgcattgttatatgcaggggccggggttcgaaccccgaacaccccacttattcaccttataag |
36008364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #12
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 183 - 268
Target Start/End: Complemental strand, 46735070 - 46734985
Alignment:
| Q |
183 |
tgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattc |
268 |
Q |
| |
|
||||||||||||||| ||||||||||||| || |||||||||||||||||||| |||||||| |||| |||||||||||||||||| |
|
|
| T |
46735070 |
tgtcccgtgagcatagctcagttggtaggacactgcattattatatgcagggatcggggttcaaacctcggacaccccacttattc |
46734985 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #13
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 189 - 278
Target Start/End: Complemental strand, 53698075 - 53697986
Alignment:
| Q |
189 |
gtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||| |||| |||||||| |||| |||||||||||||||||||||| ||||||||| |||||||||||||||||||||| |||||||||| |
|
|
| T |
53698075 |
gtgaacatagctcagttgttaggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttatttaccttataag |
53697986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #14
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 186 - 281
Target Start/End: Original strand, 9692958 - 9693054
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggc-aatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataagtga |
281 |
Q |
| |
|
|||||||||||| ||||||||| |||| ||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||| ||| |||||| |
|
|
| T |
9692958 |
cccgtgagcatagctcagttggcagggataatgcattattatatgcaggggccggggttcgaaccccggacaccccacttattcactttaaaagtga |
9693054 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #15
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 186 - 281
Target Start/End: Original strand, 14149789 - 14149885
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataagtga |
281 |
Q |
| |
|
||||||| |||| ||||||||| |||| |||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||| ||| |||||| |
|
|
| T |
14149789 |
cccgtgaccatagctcagttggcagggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttattcactttaaaagtga |
14149885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #16
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 186 - 281
Target Start/End: Complemental strand, 48968309 - 48968213
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataagtga |
281 |
Q |
| |
|
|||||||||||| |||||||| |||| |||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||| ||| |||||| |
|
|
| T |
48968309 |
cccgtgagcatagttcagttggcagggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttattcactttaaaagtga |
48968213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #17
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 182 - 277
Target Start/End: Original strand, 45350269 - 45350364
Alignment:
| Q |
182 |
atgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataa |
277 |
Q |
| |
|
||||||||| |||||| ||||||||||||| || ||||||||||||||||| | ||| |||| |||||||||||||||||||||||||||||||| |
|
|
| T |
45350269 |
atgtcccgtcagcatagctcagttggtaggacagtgcattattatatgcagaggtcggagttcgaaccccggacaccccacttattcaccttataa |
45350364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #18
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 182 - 277
Target Start/End: Original strand, 45359748 - 45359843
Alignment:
| Q |
182 |
atgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataa |
277 |
Q |
| |
|
||||||||| |||||| ||||||||||||| || ||||||||||||||||| | ||| |||| |||||||||||||||||||||||||||||||| |
|
|
| T |
45359748 |
atgtcccgtcagcatagctcagttggtaggacagtgcattattatatgcagaggtcggagttcgaaccccggacaccccacttattcaccttataa |
45359843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #19
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 186 - 273
Target Start/End: Complemental strand, 49039543 - 49039456
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
|||||||||||| ||||||||| |||| ||||||| |||||||||||||| ||||||| |||||||||||||||||||||||||||| |
|
|
| T |
49039543 |
cccgtgagcatagctcagttggcagggacatgcattgttatatgcagggactggggttcgaaccccggacaccccacttattcacctt |
49039456 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #20
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 175 - 270
Target Start/End: Complemental strand, 56546558 - 56546463
Alignment:
| Q |
175 |
cacacaaatgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcac |
270 |
Q |
| |
|
|||| ||| |||||||||||||| |||| |||||||| |||||||||||||||||||||| ||||||||| |||| | |||||||||||||||||| |
|
|
| T |
56546558 |
cacaaaaaagtcccgtgagcatagctcaattggtaggacaatgcattattatatgcaggggccggggttcgaaccacagacaccccacttattcac |
56546463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #21
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 183 - 273
Target Start/End: Original strand, 9924850 - 9924940
Alignment:
| Q |
183 |
tgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
||||||||||||||| |||||||||||| ||| |||||||||||||||||| |||||||| |||||||||||| ||||||||||||||| |
|
|
| T |
9924850 |
tgtcccgtgagcatagttcagttggtaggacaacgcattattatatgcaggggtcggggttcgaaccccggacactccacttattcacctt |
9924940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #22
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 184 - 278
Target Start/End: Complemental strand, 55656208 - 55656114
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||||||| |||||||||| || |||| ||||||||||||||||| |||| |||| || ||||||||||| |||||||||||||||||| |
|
|
| T |
55656208 |
gtcccgtgagcataactcagttggttggacaatacattattatatgcaggggccggagttcaaatcccggacaccctacttattcaccttataag |
55656114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #23
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 193 - 278
Target Start/End: Original strand, 3442847 - 3442932
Alignment:
| Q |
193 |
gcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||| ||||||||||||| ||||||||||||||||| ||| ||||||||| |||||| |||||||||||||||||||||||||| |
|
|
| T |
3442847 |
gcatagctcagttggtaggacaatgcattattatatgtcggggccggggttcgaaccccagacaccccacttattcaccttataag |
3442932 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #24
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 189 - 278
Target Start/End: Original strand, 10098125 - 10098214
Alignment:
| Q |
189 |
gtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||| |||| ||||| ||||||| |||||||||||||||||||||| ||||| ||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
10098125 |
gtgaacatagctcagctggtaggacaatgcattattatatgcaggggccgggattcgaaccccggacaccccacttattcatcttataag |
10098214 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #25
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 186 - 270
Target Start/End: Original strand, 53815692 - 53815777
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcac |
270 |
Q |
| |
|
|||||||||||| ||||||||| |||| |||||||||||||||||||||| | ||||||| ||||||||||||||||||||||||| |
|
|
| T |
53815692 |
cccgtgagcatagctcagttggcagggacaatgcattattatatgcaggggctggggttcgaaccccggacaccccacttattcac |
53815777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #26
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 183 - 278
Target Start/End: Complemental strand, 9172472 - 9172377
Alignment:
| Q |
183 |
tgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||||||||| ||||||||||||| |||||||||||||||||||||| |||||||| |||| || |||||| || ||||||||| ||||| |
|
|
| T |
9172472 |
tgtcccgtgagcataactcagttggtaggacaatgcattattatatgcaggggtcggggttcgaacctcgaacaccctacgtattcacctaataag |
9172377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #27
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 187 - 278
Target Start/End: Original strand, 12856182 - 12856273
Alignment:
| Q |
187 |
ccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||||| ||||||||||||| |||||| ||||||||| |||| ||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
12856182 |
ccgtgagcatagctcagttggtaggataatgcactattatatgaaggggtcggagttcgaaccccggacaccccacttattcaccttataag |
12856273 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #28
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 183 - 278
Target Start/End: Original strand, 17859772 - 17859867
Alignment:
| Q |
183 |
tgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||| ||||||||| ||||||||||||| ||||||||||||||| | |||| |||| |||| ||||||| ||||| ||||||||||||||||||| |
|
|
| T |
17859772 |
tgtcctgtgagcatagctcagttggtaggacaatgcattattatacgtaggggccggagttcgaaccccgaacacctcacttattcaccttataag |
17859867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #29
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 188 - 281
Target Start/End: Original strand, 8690212 - 8690306
Alignment:
| Q |
188 |
cgtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataagtga |
281 |
Q |
| |
|
|||||||||| ||||||||| | || |||||||||||||||||||||| |||||||| ||||||||||||||||||||||||| ||| |||||| |
|
|
| T |
8690212 |
cgtgagcatagctcagttggcaaggacaatgcattattatatgcaggggtcggggttcgaaccccggacaccccacttattcactttaaaagtga |
8690306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #30
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 188 - 278
Target Start/End: Complemental strand, 34773779 - 34773689
Alignment:
| Q |
188 |
cgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||| ||||||| |||| |||||||||||||||||||||| | | ||||| ||||||||||||||||||||||||| ||||||| |
|
|
| T |
34773779 |
cgtgagcatagttcagttgataggacaatgcattattatatgcaggggctgaggttcgaaccccggacaccccacttattcactttataag |
34773689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #31
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 185 - 274
Target Start/End: Original strand, 27921892 - 27921981
Alignment:
| Q |
185 |
tcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctta |
274 |
Q |
| |
|
||||||||||||| |||||||||||||| |||||||||||||||||||| ||||||||| |||||| |||| | |||||||||| |||| |
|
|
| T |
27921892 |
tcccgtgagcatagctcagttggtagggacatgcattattatatgcaggggccggggttcgaaccccagacatctcacttattcatctta |
27921981 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #32
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 183 - 276
Target Start/End: Complemental strand, 29269415 - 29269323
Alignment:
| Q |
183 |
tgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttata |
276 |
Q |
| |
|
||||||||||||||| |||||||||| || ||||||||||||||||| |||| | ||| ||| |||||||||||||||||||||||| |||||| |
|
|
| T |
29269415 |
tgtcccgtgagcatagctcagttggt-ggacaatgcattattatatgtaggggctgggattcgaaccccggacaccccacttattcatcttata |
29269323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #33
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 186 - 278
Target Start/End: Original strand, 48512195 - 48512288
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||||| ||||||||| |||| ||||||||| |||||||||||| | |||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
48512195 |
cccgtgagcatagctcagttggcagggacaatgcattgttatatgcaggggctagggttcgtaccccggacaccccacttattcaccttataag |
48512288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #34
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 188 - 273
Target Start/End: Original strand, 49319392 - 49319477
Alignment:
| Q |
188 |
cgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
|||||||||| ||||||||| | || |||||||||||||||||||| |||||||| |||||||||||||||||||||||||||| |
|
|
| T |
49319392 |
cgtgagcatagctcagttggcatggacatgcattattatatgcaggggtcggggttccaaccccggacaccccacttattcacctt |
49319477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #35
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 185 - 278
Target Start/End: Original strand, 52560760 - 52560853
Alignment:
| Q |
185 |
tcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||||||| |||| |||||||| |||||||||||||||||||||| ||||||||| |||| | |||| ||||||||||||||||||| |
|
|
| T |
52560760 |
tcccgtgagcatagctcaattggtaggacaatgcattattatatgcaggggccggggttcgaaccacatacacttcacttattcaccttataag |
52560853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #36
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 182 - 270
Target Start/End: Original strand, 22751002 - 22751090
Alignment:
| Q |
182 |
atgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcac |
270 |
Q |
| |
|
|||||||||||||||| ||||||| ||||| |||||| ||||||||||||||| |||||||| ||||||| |||||||| |||||||| |
|
|
| T |
22751002 |
atgtcccgtgagcatagctcagttcgtaggtcaatgcgttattatatgcaggggtcggggttcaaaccccgaacaccccatttattcac |
22751090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #37
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 187 - 278
Target Start/End: Complemental strand, 3544529 - 3544438
Alignment:
| Q |
187 |
ccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||| |||| ||||||||||||| ||||||||||||||||||| | ||||||||| |||||||||| ||| |||||||||| ||||||| |
|
|
| T |
3544529 |
ccgtgaacatagctcagttggtaggacaatgcattattatatgcaaaggccggggttcgaaccccggactccctacttattcacattataag |
3544438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #38
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 184 - 278
Target Start/End: Original strand, 20266857 - 20266952
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggaca-ccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||||| || |||| |||||||| |||||||||||||||||||||| || | ||| ||||||||||| |||||||||||||||||||||| |
|
|
| T |
20266857 |
gtcccgtgagcttagctcatttggtaggacaatgcattattatatgcaggggccagagtttgaaccccggacacccccacttattcaccttataag |
20266952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #39
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 183 - 278
Target Start/End: Original strand, 44074848 - 44074942
Alignment:
| Q |
183 |
tgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||| ||||||| |||||| |||||| ||||||||||||||||||||||| | |||| || |||||||||||||||||||||||||||||| |
|
|
| T |
44074848 |
tgtcccgcgagcatagctcagt-ggtaggacaatgcattattatatgcagggattgaagttcgaatcccggacaccccacttattcaccttataag |
44074942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #40
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 185 - 278
Target Start/End: Complemental strand, 534864 - 534770
Alignment:
| Q |
185 |
tcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggaca-ccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||||||| |||| |||||||| |||||||| ||||||||||||| ||||||| || |||||||| |||||||||||||||||||||| |
|
|
| T |
534864 |
tcccgtgagcatagctcaattggtaggacaatgcatcattatatgcaggggtcggggtttgaatcccggacacccccacttattcaccttataag |
534770 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #41
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 185 - 274
Target Start/End: Original strand, 33076528 - 33076615
Alignment:
| Q |
185 |
tcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctta |
274 |
Q |
| |
|
||||||||||||| ||||||||| ||| |||||||||||||||||||| |||||||| |||||||||||||| |||||||||||||| |
|
|
| T |
33076528 |
tcccgtgagcatagctcagttgg--gggacatgcattattatatgcaggggtcggggttcgaaccccggacaccctacttattcacctta |
33076615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #42
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 184 - 278
Target Start/End: Complemental strand, 33944463 - 33944369
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||||||| ||||||||||||| ||||||||||||||||||||| ||||||||| |||| || | || ||||||||||| ||||||| |
|
|
| T |
33944463 |
gtcccgtgagcataactcagttggtaggataatgcattattatatgcaggggccggggttcgaacctcgaatactccacttattcattttataag |
33944369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #43
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 200 - 278
Target Start/End: Original strand, 36576275 - 36576353
Alignment:
| Q |
200 |
tcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||| ||| || |||||||||||||||| ||||| ||| ||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
36576275 |
tcagtcggttggacaatgcattattatatacagggtccgcggttcgaaccccggacaccccacttattcaccttataag |
36576353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #44
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 185 - 281
Target Start/End: Original strand, 36954131 - 36954229
Alignment:
| Q |
185 |
tcccgtgagcatacctca-gttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataagtga |
281 |
Q |
| |
|
||||||||||||| |||| ||||| |||| |||||||||||||||||||||| |||||||| |||||||||||||||| |||||||| ||| |||||| |
|
|
| T |
36954131 |
tcccgtgagcatagctcaagttggcagggacaatgcattattatatgcaggggtcggggttcgaaccccggacaccccatttattcactttaaaagtga |
36954229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #45
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 186 - 267
Target Start/End: Complemental strand, 42411553 - 42411471
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccacttatt |
267 |
Q |
| |
|
|||||||||||| ||||||||| |||| |||||||| ||||||||||||| |||||||| |||||||||||||||||||||| |
|
|
| T |
42411553 |
cccgtgagcatagctcagttggcagggacaatgcataattatatgcaggggtcggggttcgaaccccggacaccccacttatt |
42411471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #46
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 186 - 278
Target Start/End: Complemental strand, 12820504 - 12820411
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||||| ||||||||| || | ||||||||| |||||||||||| ||||||| ||||| ||||||||||||||||||||||||||| |
|
|
| T |
12820504 |
cccgtgagcatagctcagttggcagagacaatgcattgttatatgcaggggtcggggttagaaccctggacaccccacttattcaccttataag |
12820411 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #47
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 184 - 269
Target Start/End: Complemental strand, 13211452 - 13211367
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattca |
269 |
Q |
| |
|
|||||||||| ||| |||||||||||| ||||||||||||||||||| || |||||||| |||||||||||| ||||||||||| |
|
|
| T |
13211452 |
gtcccgtgagtatagttcagttggtaggacaatgcattattatatgcatgggtcggggttcgaaccccggacactccacttattca |
13211367 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #48
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 189 - 274
Target Start/End: Original strand, 20610739 - 20610824
Alignment:
| Q |
189 |
gtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctta |
274 |
Q |
| |
|
||||||||| ||||||||| |||| ||||||| |||||||||||| ||||||||| ||| ||||||| ||||||||||||||||| |
|
|
| T |
20610739 |
gtgagcatagctcagttggcagggacatgcattgttatatgcaggggccggggttcgaactccggacatcccacttattcacctta |
20610824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #49
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 213 - 278
Target Start/End: Complemental strand, 37032250 - 37032185
Alignment:
| Q |
213 |
caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||||||||||||||| |||| ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
37032250 |
caatgcattattatatgcaggggtcgggattcgaaccccggacaccccacttattcaccttataag |
37032185 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #50
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 184 - 277
Target Start/End: Original strand, 43115263 - 43115356
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataa |
277 |
Q |
| |
|
||||||||||| || |||||||||||| ||||| |||||||||||||||| || | ||| |||||||||||||||| ||||||||||||||| |
|
|
| T |
43115263 |
gtcccgtgagcttagttcagttggtaggacaatgtattattatatgcaggggtcgagattcgaaccccggacaccccatttattcaccttataa |
43115356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #51
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 194 - 278
Target Start/End: Original strand, 6053985 - 6054069
Alignment:
| Q |
194 |
catacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||| ||||||||||||| |||||||||||||||||||||| ||||||||| ||| || ||||| ||| ||||||||||||||| |
|
|
| T |
6053985 |
catagctcagttggtaggacaatgcattattatatgcaggggccggggttcgaactccaaacaccacacgtattcaccttataag |
6054069 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #52
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 190 - 278
Target Start/End: Complemental strand, 35747576 - 35747488
Alignment:
| Q |
190 |
tgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||| |||| |||||||| ||||| |||||| ||||||||| || ||||| ||| ||||||||||||||||||||||||||||| |
|
|
| T |
35747576 |
tgagcatagctcaattggtaggacaatgtattattttatgcaggggtcgaggttcgaactccggacaccccacttattcaccttataag |
35747488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #53
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 186 - 270
Target Start/End: Original strand, 36257691 - 36257775
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcac |
270 |
Q |
| |
|
|||||||||||| ||||||||| |||| | ||| |||| ||||||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
36257691 |
cccgtgagcatagctcagttggcagggacaagcagtattgtatgcaggggccggggttcgaaccccggacaccccacttattcac |
36257775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #54
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 189 - 273
Target Start/End: Complemental strand, 42758258 - 42758175
Alignment:
| Q |
189 |
gtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
||||||||| ||||||| |||||| |||||||||||||||||||| || |||||| ||||| |||||||||||||||||||||| |
|
|
| T |
42758258 |
gtgagcatagctcagtttgtagggacatgcattattatatgcaggggcc-gggttcgaaccctggacaccccacttattcacctt |
42758175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #55
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 190 - 274
Target Start/End: Complemental strand, 52608661 - 52608578
Alignment:
| Q |
190 |
tgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctta |
274 |
Q |
| |
|
|||||||| ||||||||||||| ||||||||||||||||||| ||| ||| |||| ||||||||||| |||||||||||| |||| |
|
|
| T |
52608661 |
tgagcatagctcagttggtaggacaatgcattattatatgcatggatcggagttcgaaccccggaca-cccacttattcatctta |
52608578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #56
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 187 - 278
Target Start/End: Complemental strand, 35803190 - 35803099
Alignment:
| Q |
187 |
ccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||| |||||| |||| |||||||| |||||||||||||||||||||||||| |||| ||| | ||||||||||||||||| |||||||| |
|
|
| T |
35803190 |
ccgtaagcatagctcaattggtaggacaatgcattattatatgcagggaccgaagttcgaactctcgacaccccacttattcatcttataag |
35803099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #57
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 186 - 273
Target Start/End: Complemental strand, 41492596 - 41492510
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
|||||||||||| ||||||||| |||| |||||||||||||||||||| ||||||||| || || |||||||||||||||| ||||| |
|
|
| T |
41492596 |
cccgtgagcatagctcagttggcagggacatgcattattatatgcaggggccggggttcgaa-cctggacaccccacttatttacctt |
41492510 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #58
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 199 - 278
Target Start/End: Original strand, 51077877 - 51077956
Alignment:
| Q |
199 |
ctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||| ||| |||| || | || ||||||||||||||||||||||||| |
|
|
| T |
51077877 |
ctcagttggtaggacaatgcattattatatgcaggggtcggagttcgaatctcgaacaccccacttattcaccttataag |
51077956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #59
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 183 - 278
Target Start/End: Original strand, 53291436 - 53291531
Alignment:
| Q |
183 |
tgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||||||||| ||||||||||||| |||||||||||||||||| || ||| || || ||||||||||| |||||||||||||||||| |
|
|
| T |
53291436 |
tgtcccgtgagcataactcagttggtaggataatgcattattatatgcatgggtcggaatttgaatcccggacacccaacttattcaccttataag |
53291531 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #60
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 186 - 273
Target Start/End: Complemental strand, 54854277 - 54854190
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
|||||||||||| ||||||||| |||| |||||| ||||||||||||| | ||||||| ||||||||||| | |||||||||||||| |
|
|
| T |
54854277 |
cccgtgagcatagctcagttggcagggacatgcataattatatgcaggggctggggttcgaaccccggacatcacacttattcacctt |
54854190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #61
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 184 - 278
Target Start/End: Complemental strand, 43606200 - 43606106
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||| |||| |||||||| |||| ||||||||||||||||||||||| ||||||| || ||| ||||||||| |||| || |||||||| |
|
|
| T |
43606200 |
gtcccgtgaacatagctcagttgataggacaatgcattattatatgcagggatcggggtttaaatcccagacaccccatttatccatcttataag |
43606106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #62
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 184 - 278
Target Start/End: Complemental strand, 49089377 - 49089283
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||||| || || |||||||||| |||| ||||||||||||||||| ||| |||| |||||| |||| |||||||||||||||||||| |
|
|
| T |
49089377 |
gtcccgtgagcttagcttagttggtaggacaatacattattatatgcaggggccgaagttcgaacccctgacattccacttattcaccttataag |
49089283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #63
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 184 - 278
Target Start/End: Original strand, 50657875 - 50657969
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||||||| ||||||||||||| |||||||||||||||||||||| | ||||| ||| || ||| |||||||||||| |||||||| |
|
|
| T |
50657875 |
gtcccgtgagcatagctcagttggtaggacaatgcattattatatgcaggggtcatggttcgaactccaaacatcccacttattcatcttataag |
50657969 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #64
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 191 - 260
Target Start/End: Original strand, 5635191 - 5635260
Alignment:
| Q |
191 |
gagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacacccc |
260 |
Q |
| |
|
||||||| |||||||| |||| |||||||||||||||||||||| |||||||| ||||||||||||||| |
|
|
| T |
5635191 |
gagcatagctcagttgctaggacaatgcattattatatgcaggggtcggggttcaaaccccggacacccc |
5635260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #65
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 190 - 278
Target Start/End: Original strand, 9084759 - 9084848
Alignment:
| Q |
190 |
tgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||| ||||||||| |||| ||||||||| |||||||||||| |||| ||| |||| ||||||||||||||||||| |||||||| |
|
|
| T |
9084759 |
tgagcatagctcagttggcagggacaatgcattgttatatgcaggggtcgggattcgaacctcggacaccccacttattcatcttataag |
9084848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #66
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 201 - 278
Target Start/End: Complemental strand, 35333071 - 35332994
Alignment:
| Q |
201 |
cagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||||| |||||||||||||||||||| | |||| |||| ||| ||| |||||||| |||||||||||||||| |
|
|
| T |
35333071 |
cagttggtaggacaatgcattattatatgcagtggccggagttcgaactccgaacaccccatttattcaccttataag |
35332994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #67
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 185 - 281
Target Start/End: Original strand, 52031202 - 52031299
Alignment:
| Q |
185 |
tcccgtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataagtga |
281 |
Q |
| |
|
|||||||||| || ||||||||| ||| |||||||||| ||||||||||| |||||||| |||||| |||||||||||||||||| ||| |||||| |
|
|
| T |
52031202 |
tcccgtgagcttagctcagttggcaggaacaatgcattagtatatgcaggggtcggggttcgaaccccagacaccccacttattcactttaaaagtga |
52031299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #68
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 186 - 281
Target Start/End: Complemental strand, 15640542 - 15640446
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataagtga |
281 |
Q |
| |
|
|||||||||||| ||||||||| || | |||||||||||||||||||| | |||||||| |||| | |||||||||||||||||| ||| |||||| |
|
|
| T |
15640542 |
cccgtgagcatatctcagttggcagagacaatgcattattatatgcagtgttcggggttcgaacctcagacaccccacttattcactttaaaagtga |
15640446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #69
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 182 - 278
Target Start/End: Original strand, 38433304 - 38433400
Alignment:
| Q |
182 |
atgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||| |||| |||| ||||||| |||| ||||||||||||||||| ||| ||| |||| |||||| |||||||||||||||||||||||||| |
|
|
| T |
38433304 |
atgtcctgtgaacatagttcagttgataggacaatgcattattatatgtaggagtcggagttcgaaccccagacaccccacttattcaccttataag |
38433400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #70
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 186 - 281
Target Start/End: Original strand, 40150469 - 40150565
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataagtga |
281 |
Q |
| |
|
|||||||||||| |||||||| ||| |||||||||||||||| ||||| |||||||| ||||||||||||| ||||||||||| ||| |||||| |
|
|
| T |
40150469 |
cccgtgagcatagttcagttggcaggaacaatgcattattatatacaggggtcggggttcgaaccccggacacctcacttattcactttaaaagtga |
40150565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #71
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 190 - 278
Target Start/End: Complemental strand, 49280763 - 49280675
Alignment:
| Q |
190 |
tgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||| |||| |||||||| ||||| |||||||||||||||| ||| ||| ||||| ||||||| ||||||||||||||||||| |
|
|
| T |
49280763 |
tgagcataactcaattggtaggacaatgaattattatatgcaggggtcggtgtttgaaccctggacacctcacttattcaccttataag |
49280675 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #72
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 183 - 278
Target Start/End: Complemental strand, 6637822 - 6637728
Alignment:
| Q |
183 |
tgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||||||||| | ||||| |||| |||| ||||||||||||||||| ||||||| ||||||| |||||||||||||||| |||||||| |
|
|
| T |
6637822 |
tgtcccgtgagcatagc-cagttcgtagaacaatacattattatatgcaggggttggggttcgaaccccgaacaccccacttattcatcttataag |
6637728 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #73
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 187 - 278
Target Start/End: Complemental strand, 22478837 - 22478746
Alignment:
| Q |
187 |
ccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||||| ||| |||||||| ||||| ||||||||||| ||| ||| | ||| |||||||||||||||| |||||||||||||||| |
|
|
| T |
22478837 |
ccgtgagcataactctgttggtagtacaatgtattattatatgtcggggccgtgattcgaaccccggacaccccatttattcaccttataag |
22478746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #74
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 183 - 278
Target Start/End: Complemental strand, 40200857 - 40200762
Alignment:
| Q |
183 |
tgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||| ||| ||||||||||||| ||||||||||||||||||| | ||||||||| ||| ||| ||| ||||||||||| |||||||| |
|
|
| T |
40200857 |
tgtcccgtgaacattgctcagttggtaggacaatgcattattatatgcatgatccggggttcgaactccgaacattccacttattcatcttataag |
40200762 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #75
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 183 - 270
Target Start/End: Complemental strand, 46482918 - 46482831
Alignment:
| Q |
183 |
tgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcac |
270 |
Q |
| |
|
||||||||||||||| |||||||||||| |||| |||||||||||||||| |||| |||| |||| ||||| ||||||||||||| |
|
|
| T |
46482918 |
tgtcccgtgagcataattcagttggtaggacaatacattattatatgcaggagccggtgttcgaacctcggacgtcccacttattcac |
46482831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #76
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 186 - 273
Target Start/End: Original strand, 49743359 - 49743446
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
|||| ||||||| |||||||| |||| |||||||||||||||||||| ||||| ||| ||||||||||||| |||||||| ||||| |
|
|
| T |
49743359 |
cccgcgagcatagttcagttggcagggatatgcattattatatgcaggggccgggattcgaaccccggacacctcacttatttacctt |
49743446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #77
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 188 - 278
Target Start/End: Original strand, 6365323 - 6365413
Alignment:
| Q |
188 |
cgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||| | ||||||||||| |||||||||||||||||||||| || ||| |||||| ||||| | || |||||||||||||||| |
|
|
| T |
6365323 |
cgtgagcataacccagttggtaggacaatgcattattatatgcaggggtcgaagttataaccctggacatctcatttattcaccttataag |
6365413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #78
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 184 - 278
Target Start/End: Complemental strand, 12868126 - 12868033
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||| |||||||| || |||||||||| |||||||||||||||||||| | | | ||||| || |||| ||| ||||||||||||||||||||| |
|
|
| T |
12868126 |
gtcccttgagcataacttagttggtaggacaatgcattattatatgcagtg-ctgaggttcgaatcccgaacatcccacttattcaccttataag |
12868033 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #79
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 184 - 278
Target Start/End: Original strand, 15021420 - 15021514
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||| ||||||||| ||||| ||||| ||||||| |||||| |||| ||| |||| |||| ||||||| ||| ||||||||||||||||||||| |
|
|
| T |
15021420 |
gtcctgtgagcatagctcagctggtatggcaatgaattattgtatgtaggagccggagttcgaaccccgaacagcccacttattcaccttataag |
15021514 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #80
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 189 - 266
Target Start/End: Complemental strand, 56531332 - 56531254
Alignment:
| Q |
189 |
gtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccacttat |
266 |
Q |
| |
|
||||||||| ||||||||| | || ||||||||| |||||||||||| ||||||||| ||| ||||||||||||||||| |
|
|
| T |
56531332 |
gtgagcatagctcagttggcaaggacaatgcattgttatatgcaggggccggggttcgaactccggacaccccacttat |
56531254 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #81
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 184 - 277
Target Start/End: Complemental strand, 21476181 - 21476088
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataa |
277 |
Q |
| |
|
|||||||||||||| |||||||| |||| | ||||||||||||||||||| || |||| ||| ||||||| |||||||||||| ||||||| |
|
|
| T |
21476181 |
gtcccgtgagcatagctcagttgataggatattgcattattatatgcaggggtcgatgttcgaactccggacatcccacttattcatcttataa |
21476088 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #82
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 184 - 269
Target Start/End: Complemental strand, 23661458 - 23661373
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattca |
269 |
Q |
| |
|
||||||||| |||| |||||||| |||| ||||||||| ||||||| |||| ||||||| ||||||| |||||||||||||||| |
|
|
| T |
23661458 |
gtcccgtgaacatagctcagttgctaggacaatgcattgttatatgtaggggtaggggttcgaaccccgaacaccccacttattca |
23661373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #83
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 188 - 277
Target Start/End: Original strand, 35031382 - 35031471
Alignment:
| Q |
188 |
cgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataa |
277 |
Q |
| |
|
|||||||||| ||||||||||||| ||||||||||||||||||||| ||| ||||| |||||| || | |||| ||||| || |||||| |
|
|
| T |
35031382 |
cgtgagcatagctcagttggtaggacaatgcattattatatgcaggagccgaggttcgaaccccagatatcccatttatttactttataa |
35031471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #84
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 190 - 278
Target Start/End: Complemental strand, 6331030 - 6330942
Alignment:
| Q |
190 |
tgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||| || |||||||||||| ||| |||||||||||| |||| ||||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
6331030 |
tgagcgtaactcagttggtagaataatacattattatatgtaggggttggggttcaaatcccggacaccccacttattcaccttataag |
6330942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #85
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 218 - 270
Target Start/End: Complemental strand, 7768854 - 7768802
Alignment:
| Q |
218 |
cattattatatgcagggaccggggttctaaccccggacaccccacttattcac |
270 |
Q |
| |
|
||||||||||||||| | ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
7768854 |
cattattatatgcagaggccggggttcgaaccccggacaccccacttattcac |
7768802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #86
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 185 - 277
Target Start/End: Original strand, 26253948 - 26254040
Alignment:
| Q |
185 |
tcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataa |
277 |
Q |
| |
|
|||| |||||||| ||||||||||| ||||| |||||||||||||||| ||| |||| || ||||||||| |||||||||||| |||||| |
|
|
| T |
26253948 |
tcccatgagcatagttcagttggtagaacaatgtattattatatgcaggggtcggagttcgaatcccggacactccacttattcactttataa |
26254040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #87
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 199 - 278
Target Start/End: Complemental strand, 27584144 - 27584064
Alignment:
| Q |
199 |
ctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggaca-ccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||||| | ||||||||||||||||| |||| || |||||| |||| || ||| |||||||||||||||||||||| |
|
|
| T |
27584144 |
ctcagttggtatgacaatgcattattatatggaggggccagggttcgaacctcgaacacccccacttattcaccttataag |
27584064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #88
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 199 - 278
Target Start/End: Original strand, 1297863 - 1297942
Alignment:
| Q |
199 |
ctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||||||| ||| ||||||||||||||||| |||| ||| ||||| | |||| |||||||||||||||||||| |
|
|
| T |
1297863 |
ctcagttggtaggacaacacattattatatgcaggggtcgggattcgaaccctgaacactccacttattcaccttataag |
1297942 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #89
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 183 - 242
Target Start/End: Complemental strand, 4722565 - 4722506
Alignment:
| Q |
183 |
tgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggt |
242 |
Q |
| |
|
|||||||||| |||| ||||||||||||| |||||||||||||||||||| | ||||||| |
|
|
| T |
4722565 |
tgtcccgtgaacatagctcagttggtaggacaatgcattattatatgcagaggccggggt |
4722506 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #90
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 186 - 264
Target Start/End: Original strand, 8965094 - 8965172
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaat-gcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||||||| || |||||||||||||| || |||| ||||||||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
8965094 |
cccgtgagcttagctcagttggtagggatattgcat-attatatgcaggggccggggttcgaaccccggacaccccactt |
8965172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #91
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 199 - 278
Target Start/End: Complemental strand, 10757860 - 10757781
Alignment:
| Q |
199 |
ctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||||| ||| |||||||||||| || | || | |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
10757860 |
ctcagttggtagaacaacgcattattatattgagaggccagagttcgaaccccggacaccccacttattcaccttataag |
10757781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #92
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 199 - 278
Target Start/End: Complemental strand, 10971031 - 10970952
Alignment:
| Q |
199 |
ctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||||| ||| |||||||||||| || | || | |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
10971031 |
ctcagttggtagaacaacgcattattatattgagaggccagagttcgaaccccggacaccccacttattcaccttataag |
10970952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #93
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 199 - 278
Target Start/End: Complemental strand, 13073239 - 13073161
Alignment:
| Q |
199 |
ctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||| |||||| | ||||||||||||||||| ||||| |||||||| || |||||||| |||||||||| |||||||||| |
|
|
| T |
13073239 |
ctcaattggtatgacaatgcattattatatgtagggatcggggttcgaa-cccggacatcccacttattaaccttataag |
13073161 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #94
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 186 - 273
Target Start/End: Original strand, 20166313 - 20166400
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
||||||||| || ||||||||| |||| ||||||| |||||||||||| ||| ||||| |||||| || ||||||||||||| |||| |
|
|
| T |
20166313 |
cccgtgagcgtagctcagttggcagggacatgcattgttatatgcaggggccgaggttcgaaccccagataccccacttattctcctt |
20166400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #95
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 186 - 273
Target Start/End: Original strand, 29785147 - 29785234
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
|||||||||||| ||||||||| |||| || || | | ||||| |||| | ||||||| |||||||||||||||||||||||||||| |
|
|
| T |
29785147 |
cccgtgagcatagctcagttggcagggacatacactgtaatatgtaggggctggggttcgaaccccggacaccccacttattcacctt |
29785234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #96
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 184 - 278
Target Start/End: Original strand, 31578014 - 31578106
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||| |||| || |||||||||| |||||||||||||||||| || ||| ||| || |||||||||||||||||||||| ||||||| |
|
|
| T |
31578014 |
gtcccgtgaacatagctgagttggtaggacaatgcattattatatgc--gggttgggattcgaaacccggacaccccacttattcacattataag |
31578106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #97
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 199 - 274
Target Start/End: Complemental strand, 37997931 - 37997856
Alignment:
| Q |
199 |
ctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctta |
274 |
Q |
| |
|
||||||||| |||| || |||| |||||||||||| | ||||||| |||||| |||||||||||||||||||||| |
|
|
| T |
37997931 |
ctcagttggcagggacattcattgttatatgcagggtctggggttcgaaccccagacaccccacttattcacctta |
37997856 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #98
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 183 - 278
Target Start/End: Original strand, 39992830 - 39992924
Alignment:
| Q |
183 |
tgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||| |||||||||| ||||||| |||| |||||||||| ||||||||||| | |||||| || | ||||||||||||||||||||||||||| |
|
|
| T |
39992830 |
tgtctcgtgagcatagctcagttattaggacaatgcattaatatatgcaggg-gctgggttcgaattctggacaccccacttattcaccttataag |
39992924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #99
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 214 - 277
Target Start/End: Original strand, 43336986 - 43337049
Alignment:
| Q |
214 |
aatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataa |
277 |
Q |
| |
|
|||||||||||||||| ||||| |||||||| || |||| |||||||||||||||| ||||||| |
|
|
| T |
43336986 |
aatgcattattatatgtagggatcggggttcgaatcccgaacaccccacttattcatcttataa |
43337049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #100
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 180 - 231
Target Start/End: Original strand, 52743219 - 52743270
Alignment:
| Q |
180 |
aaatgtcccgtgagcatacctcagttggtagggcaatgcattattatatgca |
231 |
Q |
| |
|
|||||||||||||||||| ||| ||||||||| ||||||||||||||||||| |
|
|
| T |
52743219 |
aaatgtcccgtgagcatagctcggttggtaggacaatgcattattatatgca |
52743270 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #101
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 187 - 270
Target Start/End: Original strand, 56314759 - 56314842
Alignment:
| Q |
187 |
ccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcac |
270 |
Q |
| |
|
|||||| |||| ||| |||||||| |||||||||||||||||||||| | |||||| |||| |||||||| ||||||||||| |
|
|
| T |
56314759 |
ccgtgatcatagttcaattggtaggacaatgcattattatatgcaggggtcagggttcgaaccacggacaccacacttattcac |
56314842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #102
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 188 - 278
Target Start/End: Complemental strand, 26203883 - 26203793
Alignment:
| Q |
188 |
cgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||| ||||||||||||| || ||||||||||||| |||| |||||| |||||| |||| |||||||||||| |||||||| |
|
|
| T |
26203883 |
cgtgagcatagctcagttggtaggacagtgcattattatataaaggggttggggtttgaacccctgacatcccacttattcatcttataag |
26203793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #103
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 191 - 273
Target Start/End: Complemental strand, 35230388 - 35230306
Alignment:
| Q |
191 |
gagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
||||||| |||||||||||||| ||||||| |||||||| || |||||||| |||| ||||||||||||||||| ||||| |
|
|
| T |
35230388 |
gagcatagctcagttggtagggatatgcattgctatatgcatgggtcggggttcgaacctcggacaccccacttatttacctt |
35230306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #104
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 204 - 278
Target Start/End: Complemental strand, 35451201 - 35451127
Alignment:
| Q |
204 |
ttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||| | |||||||||||||||||||||| ||| |||| ||| |||||||| ||||||||||||||||||| |
|
|
| T |
35451201 |
ttggtatgacaatgcattattatatgcaggggtcggagttcgaactacggacacctcacttattcaccttataag |
35451127 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #105
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 186 - 264
Target Start/End: Complemental strand, 47934142 - 47934064
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||||||| || |||||||||||||| ||| |||||||||||||| ||||||||| |||||||||||| |||||| |
|
|
| T |
47934142 |
cccgtgagcttagctcagttggtagggatatggcatattatatgcaggggccggggttcgaaccccggacactccactt |
47934064 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #106
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 183 - 233
Target Start/End: Complemental strand, 50783535 - 50783485
Alignment:
| Q |
183 |
tgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagg |
233 |
Q |
| |
|
||||||||||||||| ||||||||||||| || |||||||||||||||||| |
|
|
| T |
50783535 |
tgtcccgtgagcatagctcagttggtaggacattgcattattatatgcagg |
50783485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #107
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 185 - 278
Target Start/End: Complemental strand, 55266534 - 55266443
Alignment:
| Q |
185 |
tcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||||||| |||||||||||| |||||||||||||||||||||| ||| |||| || |||| ||| || | ||||||||||||||| |
|
|
| T |
55266534 |
tcccgtgagcatagctcagttggtagaacaatgcattattatatgcaggggtcggagttcgaatcccgaacatccta--tattcaccttataag |
55266443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #108
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 221 - 270
Target Start/End: Complemental strand, 13264309 - 13264260
Alignment:
| Q |
221 |
tattatatgcagggaccggggttctaaccccggacaccccacttattcac |
270 |
Q |
| |
|
||||||||||| |||||||||||| ||||||||||||||||||| ||||| |
|
|
| T |
13264309 |
tattatatgcaaggaccggggttcgaaccccggacaccccacttcttcac |
13264260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #109
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 204 - 277
Target Start/End: Complemental strand, 43327405 - 43327332
Alignment:
| Q |
204 |
ttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataa |
277 |
Q |
| |
|
|||||||| ||||||||||||||||||||| |||||| ||||||| |||||||||||||| ||||||||| |
|
|
| T |
43327405 |
ttggtaggataatgcattattatatgcagggggttgggttcgaaccccgcacaccccacttatttaccttataa |
43327332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #110
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 189 - 278
Target Start/End: Original strand, 46937262 - 46937351
Alignment:
| Q |
189 |
gtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||| ||||||||||||| ||||||||||| |||| ||| | ||| ||| |||| ||||||| | |||||||||||||||||| |
|
|
| T |
46937262 |
gtgagcatagctcagttggtaggacaatgcattataatatacagatattgggtttcgaacctcggacactcaacttattcaccttataag |
46937351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #111
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 224 - 281
Target Start/End: Complemental strand, 52330969 - 52330912
Alignment:
| Q |
224 |
tatatgcagggaccggggttctaaccccggacaccccacttattcaccttataagtga |
281 |
Q |
| |
|
||||||||||| ||||||||| ||| ||||||||||||||||||||| ||| |||||| |
|
|
| T |
52330969 |
tatatgcaggggccggggttcgaactccggacaccccacttattcactttaaaagtga |
52330912 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #112
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 189 - 273
Target Start/End: Complemental strand, 56955 - 56871
Alignment:
| Q |
189 |
gtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
||||||||| ||||||||| |||| ||||||| ||||||||| || |||| |||| ||| ||| |||||||| ||||||||||| |
|
|
| T |
56955 |
gtgagcataactcagttggcagggacatgcattgttatatgcaagggccggagttcgaactccgaacaccccatttattcacctt |
56871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #113
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 214 - 278
Target Start/End: Original strand, 22158272 - 22158336
Alignment:
| Q |
214 |
aatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||||||||||||||| |||||||| || | |||||| || |||||||||||||||||| |
|
|
| T |
22158272 |
aatgcattattatatgcaggggtcggggttcgaaactcggacatccaacttattcaccttataag |
22158336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #114
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 185 - 273
Target Start/End: Complemental strand, 35909262 - 35909175
Alignment:
| Q |
185 |
tcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
|||||||| |||| |||||||||||| |||| ||||||||||||||| | |||||||| |||||||||| |||| ||||||||||| |
|
|
| T |
35909262 |
tcccgtgaacatagttcagttggtaggacaatacattattatatgcagaggtcggggttcgaaccccggac-tcccatttattcacctt |
35909175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #115
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 221 - 273
Target Start/End: Original strand, 38690698 - 38690750
Alignment:
| Q |
221 |
tattatatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
|||||||||||||| |||||||| ||||||||||||||||||||||| |||| |
|
|
| T |
38690698 |
tattatatgcaggggtcggggttcgaaccccggacaccccacttattctcctt |
38690750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #116
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 202 - 278
Target Start/End: Original strand, 44975921 - 44975997
Alignment:
| Q |
202 |
agttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||| ||||| |||||| ||||||||| ||||||| || | |||||| ||||||||||||||||||||| |
|
|
| T |
44975921 |
agttggtaggacaatgtattattgtatgcaggggttggggttcgaatctcggacatcccacttattcaccttataag |
44975997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #117
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 213 - 281
Target Start/End: Original strand, 46799432 - 46799499
Alignment:
| Q |
213 |
caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataagtga |
281 |
Q |
| |
|
|||||||||||||||||||| | ||| ||||| |||||||||||||||| |||||||| ||| |||||| |
|
|
| T |
46799432 |
caatgcattattatatgcagag-ccgaggttcgaaccccggacaccccatttattcactttaaaagtga |
46799499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #118
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 186 - 264
Target Start/End: Complemental strand, 3036125 - 3036047
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaat-gcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||||||| || |||||||||||||| || |||| ||||||||||||| ||| ||||| ||||||||||||||||||| |
|
|
| T |
3036125 |
cccgtgagcttaactcagttggtagggatattgcat-attatatgcaggggccgaggttcgaaccccggacaccccactt |
3036047 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #119
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 190 - 273
Target Start/End: Complemental strand, 11863247 - 11863164
Alignment:
| Q |
190 |
tgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
|||||||| |||| ||||||||| ||||| |||||||||||||||| | ||||| ||| | ||||||| ||||||||||||| |
|
|
| T |
11863247 |
tgagcatagctcaattggtagggacatgcactattatatgcagggactgaggttcgaacttcagacaccctacttattcacctt |
11863164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #120
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 221 - 264
Target Start/End: Original strand, 21935512 - 21935555
Alignment:
| Q |
221 |
tattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
21935512 |
tattatatgcaggggccggggttcgaaccccggacaccccactt |
21935555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #121
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 239 - 278
Target Start/End: Complemental strand, 28221352 - 28221313
Alignment:
| Q |
239 |
gggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
28221352 |
gggttcgaaccccggacaccccacttattcaccttataag |
28221313 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #122
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 226 - 273
Target Start/End: Original strand, 37574309 - 37574356
Alignment:
| Q |
226 |
tatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
||||||||| ||||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
37574309 |
tatgcaggggccggggttcaaaccccgggcaccccacttattcacctt |
37574356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #123
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 186 - 264
Target Start/End: Complemental strand, 45112181 - 45112103
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaat-gcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||||||| ||||||||||||||||| || |||| |||||||||||| ||||||||| |||||||||||| |||||| |
|
|
| T |
45112181 |
cccgtgagcttacctcagttggtagggatattgcat-attatatgcaggagccggggttcgaaccccggacactccactt |
45112103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #124
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 199 - 270
Target Start/End: Original strand, 47416478 - 47416549
Alignment:
| Q |
199 |
ctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcac |
270 |
Q |
| |
|
||||||||||||| |||| |||||||||||||||| ||||||| || | |||||||||||||||||||| |
|
|
| T |
47416478 |
ctcagttggtaggataatggattattatatgcaggggttggggttcgaatctcggacaccccacttattcac |
47416549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #125
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 186 - 260
Target Start/End: Original strand, 49901482 - 49901556
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaat-gcattattatatgcagggaccggggttctaaccccggacacccc |
260 |
Q |
| |
|
||||||||| || |||||||||||||| || |||| ||||||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
49901482 |
cccgtgagcttagctcagttggtagggatattgcat-attatatgcaggggccggggttcgaaccccggacacccc |
49901556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #126
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 186 - 264
Target Start/End: Original strand, 51890797 - 51890875
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||||||| || ||||||||| |||| || ||||| ||| ||||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
51890797 |
cccgtgagcttagctcagttggcagggacattgcataatt-tatgcaggggccggggttcgaaccccggacaccccactt |
51890875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #127
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 186 - 264
Target Start/End: Original strand, 55055916 - 55055994
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||||||| || |||||||||||||| |||||||| ||| ||||||||| ||| ||||| |||||||||||| |||||| |
|
|
| T |
55055916 |
cccgtgagcttagctcagttggtagggacaatgcat-attttatgcaggggccgaggttcgaaccccggacacgccactt |
55055994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #128
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 186 - 267
Target Start/End: Original strand, 2565257 - 2565339
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccacttatt |
267 |
Q |
| |
|
|||||||||||| |||||||| |||| ||||||||| |||||||||||| ||| |||| || |||| |||||||||||||| |
|
|
| T |
2565257 |
cccgtgagcatagctcagttgacagggacaatgcattgttatatgcaggggtcggagttcgaatcccgaacaccccacttatt |
2565339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #129
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 187 - 264
Target Start/End: Complemental strand, 13578534 - 13578457
Alignment:
| Q |
187 |
ccgtgagcatacctcagttggtagggcaat-gcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
|||||||| || |||||||||||||| || |||| ||||||||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
13578534 |
ccgtgagcttaactcagttggtagggatattgcat-attatatgcaggggtcggggttcgaaccccggacaccccactt |
13578457 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #130
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 189 - 279
Target Start/End: Original strand, 16201296 - 16201386
Alignment:
| Q |
189 |
gtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataagt |
279 |
Q |
| |
|
|||| |||| ||||||||||||| ||||||||||||| ||| |||| |||||| ||| ||||||| || | ||||||||||||||||| |
|
|
| T |
16201296 |
gtgaccatagctcagttggtaggacaatgcattattacatgtaggggttggggtttgaactccggacatcctatttattcaccttataagt |
16201386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #131
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 187 - 269
Target Start/End: Original strand, 30369344 - 30369425
Alignment:
| Q |
187 |
ccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattca |
269 |
Q |
| |
|
|||||||| || || |||||||||| ||||||||| |||||||||||| || | ||| ||| |||||||||||||||||||| |
|
|
| T |
30369344 |
ccgtgagcttaacttagttggtaggacaatgcattgttatatgcaggg-ccagaattcgaactccggacaccccacttattca |
30369425 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #132
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 214 - 264
Target Start/End: Complemental strand, 36099224 - 36099175
Alignment:
| Q |
214 |
aatgcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
|||||||| |||||||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
36099224 |
aatgcatt-ttatatgcaggggccggggttcgaaccccggacaccccactt |
36099175 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #133
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 236 - 278
Target Start/End: Original strand, 37274627 - 37274669
Alignment:
| Q |
236 |
ccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
37274627 |
ccggggttcgaaccccggacaccccacttattcatcttataag |
37274669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #134
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 192 - 278
Target Start/End: Complemental strand, 54305020 - 54304935
Alignment:
| Q |
192 |
agcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||| |||||||||||| ||||||||||| ||||| |||| || |||||| || |||| ||| |||||||||||| |||||||| |
|
|
| T |
54305020 |
agcataactcagttggtagaacaatgcattatcatatgtaggggcc-gggttcgaatcccgaacatcccacttattcagcttataag |
54304935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #135
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 223 - 264
Target Start/End: Original strand, 2222576 - 2222617
Alignment:
| Q |
223 |
ttatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
|||||||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
2222576 |
ttatatgcaggggccggggttcgaaccccggacaccccactt |
2222617 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #136
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 188 - 273
Target Start/End: Complemental strand, 4419782 - 4419697
Alignment:
| Q |
188 |
cgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
|||||||||| |||||||| || | ||||||| |||||||||||| ||||||||| ||||| | ||||| || ||||||||||| |
|
|
| T |
4419782 |
cgtgagcataactcagttgtcagagacatgcattgttatatgcaggggccggggttcaaacccagaacacctcatttattcacctt |
4419697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #137
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 186 - 270
Target Start/End: Original strand, 6371114 - 6371198
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaat-gcattattatatgcagggaccggggttctaaccccggacaccccacttattcac |
270 |
Q |
| |
|
||||||||| || |||||||||||||| || |||| |||||||||||| ||||||||| |||||||||||| |||||| ||||| |
|
|
| T |
6371114 |
cccgtgagcttagctcagttggtagggatattgcat-attatatgcaggagccggggttcgaaccccggacactccacttcttcac |
6371198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #138
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 224 - 273
Target Start/End: Original strand, 6930589 - 6930638
Alignment:
| Q |
224 |
tatatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
||||||||||| ||||| ||| ||| |||||||||||||||||||||||| |
|
|
| T |
6930589 |
tatatgcaggggccgggattcaaactccggacaccccacttattcacctt |
6930638 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #139
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 194 - 274
Target Start/End: Original strand, 31480275 - 31480356
Alignment:
| Q |
194 |
catacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctta |
274 |
Q |
| |
|
|||| ||||||||| |||| ||||||||| |||||||||||| | | ||| ||||||| ||||||||||||||||||||| |
|
|
| T |
31480275 |
catagctcagttggcagggacaatgcattgttatatgcaggggctgaaattcgaaccccgaacaccccacttattcacctta |
31480356 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #140
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 186 - 266
Target Start/End: Original strand, 34106598 - 34106678
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccacttat |
266 |
Q |
| |
|
|||||||||||| ||||||||| ||| |||||||||||||||||||| | | |||||| |||||| |||||||||||||| |
|
|
| T |
34106598 |
cccgtgagcatagctcagttggcaggaacaatgcattattatatgcagaggtc-gggttcgaaccccagacaccccacttat |
34106678 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #141
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 189 - 262
Target Start/End: Original strand, 37728939 - 37729012
Alignment:
| Q |
189 |
gtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccac |
262 |
Q |
| |
|
||||||||| ||||||||||||| |||||||||||||||||||| || ||||| ||| |||||||| |||| |
|
|
| T |
37728939 |
gtgagcatagttcagttggtagggatatgcattattatatgcaggggtcgaggttcgaactccggacactccac |
37729012 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #142
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 221 - 270
Target Start/End: Complemental strand, 37889669 - 37889620
Alignment:
| Q |
221 |
tattatatgcagggaccggggttctaaccccggacaccccacttattcac |
270 |
Q |
| |
|
|||||||||||||| |||||||| ||||||||||||| ||||||||||| |
|
|
| T |
37889669 |
tattatatgcaggggtcggggttcgaaccccggacacctcacttattcac |
37889620 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #143
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 223 - 264
Target Start/End: Original strand, 43905747 - 43905788
Alignment:
| Q |
223 |
ttatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||||||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
43905747 |
ttatatgcagggatcggggttcgaaccccggacaccccactt |
43905788 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #144
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 228 - 269
Target Start/End: Complemental strand, 45847982 - 45847941
Alignment:
| Q |
228 |
tgcagggaccggggttctaaccccggacaccccacttattca |
269 |
Q |
| |
|
|||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
45847982 |
tgcagggatcggggttcgaaccccggacaccccacttattca |
45847941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #145
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 189 - 281
Target Start/End: Complemental strand, 48501754 - 48501661
Alignment:
| Q |
189 |
gtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataagtga |
281 |
Q |
| |
|
||||||||| |||| |||| ||| ||||| |||||||||||||||| | ||||||| ||| || ||||||||||||||||| ||| |||||| |
|
|
| T |
48501754 |
gtgagcataactcaattggcggggacaatgtattattatatgcaggggctggggttcgaacatcgaacaccccacttattcactttaaaagtga |
48501661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #146
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 188 - 277
Target Start/End: Complemental strand, 52136664 - 52136575
Alignment:
| Q |
188 |
cgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataa |
277 |
Q |
| |
|
|||||||||| |||||||| | | |||||||||||||||||| ||| ||| ||| ||||||||| ||| |||| ||||||||||||| |
|
|
| T |
52136664 |
cgtgagcatagctcagttgattagacaatgcattattatatgctggggttgggattcgaaccccggatacctcactcattcaccttataa |
52136575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #147
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 184 - 239
Target Start/End: Complemental strand, 438479 - 438423
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggc-aatgcattattatatgcagggaccgg |
239 |
Q |
| |
|
|||||||||||||| |||||||||||| | ||||||||||||||||||||| |||| |
|
|
| T |
438479 |
gtcccgtgagcatagctcagttggtagaacaaatgcattattatatgcaggggccgg |
438423 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #148
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 185 - 264
Target Start/End: Complemental strand, 22230505 - 22230426
Alignment:
| Q |
185 |
tcccgtgagcatacctcagttggtagggcaat-gcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
|||||||||| || |||||||||||||| || |||| |||||||||||| ||||||||| |||||||||||| |||||| |
|
|
| T |
22230505 |
tcccgtgagcttagctcagttggtagggatattgcat-attatatgcaggagccggggttcgaaccccggacactccactt |
22230426 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #149
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 186 - 257
Target Start/End: Original strand, 26250647 - 26250718
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacac |
257 |
Q |
| |
|
|||||||||||| |||||||||||||| || ||||| ||| ||||||||| ||||||||| || ||||||||| |
|
|
| T |
26250647 |
cccgtgagcataactcagttggtagggacattgcataatt-tatgcaggggccggggttcgaatcccggacac |
26250718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #150
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 221 - 269
Target Start/End: Original strand, 29430529 - 29430577
Alignment:
| Q |
221 |
tattatatgcagggaccggggttctaaccccggacaccccacttattca |
269 |
Q |
| |
|
|||||||||||| || |||||||| |||||||||||||| ||||||||| |
|
|
| T |
29430529 |
tattatatgcagtgatcggggttcgaaccccggacaccctacttattca |
29430577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #151
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 202 - 270
Target Start/End: Original strand, 44272949 - 44273017
Alignment:
| Q |
202 |
agttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcac |
270 |
Q |
| |
|
|||||||| || |||||||||||||||||||| ||| |||| |||| |||| ||||||||||||||| |
|
|
| T |
44272949 |
agttggtatggacatgcattattatatgcaggggtcggagttcgaacctcggataccccacttattcac |
44273017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #152
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 185 - 264
Target Start/End: Complemental strand, 45139952 - 45139873
Alignment:
| Q |
185 |
tcccgtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
|||||||||| || |||||||||||||| || || || ||| ||||||||| ||||||||| ||||||||||||| ||||| |
|
|
| T |
45139952 |
tcccgtgagcttagctcagttggtagggacattgtataatt-tatgcaggggccggggttcgaaccccggacacctcactt |
45139873 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #153
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 214 - 278
Target Start/End: Complemental strand, 45141303 - 45141239
Alignment:
| Q |
214 |
aatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||||||||| || || |||||||| ||||||||||||| |||||||||| ||||||| |
|
|
| T |
45141303 |
aatgcattattatatacaagggtcggggttcgaaccccggacacctcacttattcatgttataag |
45141239 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #154
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 227 - 267
Target Start/End: Complemental strand, 53355023 - 53354983
Alignment:
| Q |
227 |
atgcagggaccggggttctaaccccggacaccccacttatt |
267 |
Q |
| |
|
|||||||| ||||||||| |||||||||||||||||||||| |
|
|
| T |
53355023 |
atgcaggggccggggttcgaaccccggacaccccacttatt |
53354983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #155
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 180 - 231
Target Start/End: Complemental strand, 6710315 - 6710264
Alignment:
| Q |
180 |
aaatgtcccgtgagcatacctcagttggtagggcaatgcattattatatgca |
231 |
Q |
| |
|
||||||||| |||||||| || ||||||| || ||||||||||||||||||| |
|
|
| T |
6710315 |
aaatgtcccatgagcatagcttagttggttggacaatgcattattatatgca |
6710264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #156
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 221 - 264
Target Start/End: Complemental strand, 11375924 - 11375881
Alignment:
| Q |
221 |
tattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||||||||| ||||| |
|
|
| T |
11375924 |
tattatatgcaggggccggggttcgaaccccggacacctcactt |
11375881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #157
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 186 - 264
Target Start/End: Original strand, 18360493 - 18360571
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaatg-cattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||||||| || |||||||||||||| || |||| |||||||||||| ||||||||| |||||||||||| |||||| |
|
|
| T |
18360493 |
cccgtgagcttagctcagttggtagggatatcacatt-ttatatgcaggggccggggttcgaaccccggacactccactt |
18360571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #158
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 187 - 234
Target Start/End: Original strand, 20181209 - 20181256
Alignment:
| Q |
187 |
ccgtgagcatacctcagttggtagggcaatgcattattatatgcaggg |
234 |
Q |
| |
|
||||||||||| ||||||||||||| ||||||| ||||||||| |||| |
|
|
| T |
20181209 |
ccgtgagcatagctcagttggtaggacaatgcagtattatatgtaggg |
20181256 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #159
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 204 - 274
Target Start/End: Original strand, 23376199 - 23376269
Alignment:
| Q |
204 |
ttggtagggcaatgcattattatatgcagggaccggggttctaaccccg-gacaccccacttattcacctta |
274 |
Q |
| |
|
|||||||| ||||| ||||||||||| ||| | |||||||| |||||| |||||||||||||||||||||| |
|
|
| T |
23376199 |
ttggtaggacaatgtattattatatgtagg-atcggggttcgaacccccagacaccccacttattcacctta |
23376269 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #160
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 221 - 264
Target Start/End: Original strand, 30057257 - 30057300
Alignment:
| Q |
221 |
tattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
|||||||||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
30057257 |
tattatatgcaggggtcggggttcaaaccccggacaccccactt |
30057300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #161
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 247 - 278
Target Start/End: Original strand, 30152172 - 30152203
Alignment:
| Q |
247 |
accccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||||||||||||||||||||||||| |
|
|
| T |
30152172 |
accccggacaccccacttattcaccttataag |
30152203 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #162
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 186 - 273
Target Start/End: Original strand, 33359814 - 33359901
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
|||||||||||| |||||||| | || || |||| ||||||||| || || ||||| ||||| |||||||||||||||||||||| |
|
|
| T |
33359814 |
cccgtgagcatagctcagttgacatggacattcattgttatatgcaagggtcgaggttcgaaccctggacaccccacttattcacctt |
33359901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #163
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 186 - 264
Target Start/End: Complemental strand, 33933809 - 33933731
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||||||| || |||||||||||||| || ||||| || |||||||||| ||||||||| | ||| ||||||||||||| |
|
|
| T |
33933809 |
cccgtgagcttagctcagttggtagggacattgcataat-atatgcaggggccggggttcgacccctggacaccccactt |
33933731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #164
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 202 - 277
Target Start/End: Original strand, 35112721 - 35112796
Alignment:
| Q |
202 |
agttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataa |
277 |
Q |
| |
|
|||||||||| |||||||||||||||| |||| |||||||| ||| |||||| ||| |||||| ||||||||| |
|
|
| T |
35112721 |
agttggtaggataatgcattattatatgtaggggtcggggttcgaacatcggacatcccgcttatttaccttataa |
35112796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #165
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 186 - 264
Target Start/End: Complemental strand, 36602436 - 36602358
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaatg-cattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||||||| || |||||||||||||| || |||| |||||||||||| ||||||||| |||||||||||| |||||| |
|
|
| T |
36602436 |
cccgtgagcttagctcagttggtagggatatcacatt-ttatatgcaggggccggggttcgaaccccggacactccactt |
36602358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #166
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 187 - 234
Target Start/End: Original strand, 39293519 - 39293566
Alignment:
| Q |
187 |
ccgtgagcatacctcagttggtagggcaatgcattattatatgcaggg |
234 |
Q |
| |
|
||||||||||| |||||||||||||| |||||| ||||||||||||| |
|
|
| T |
39293519 |
ccgtgagcatagctcagttggtagggacatgcataattatatgcaggg |
39293566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #167
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 186 - 264
Target Start/End: Complemental strand, 43147454 - 43147376
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaat-gcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||||||| || |||||||||||||| || |||| |||||||||||| ||||||||| |||||||||||| |||||| |
|
|
| T |
43147454 |
cccgtgagcttagctcagttggtagggatattgcat-attatatgcaggagccggggttcgaaccccggacactccactt |
43147376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #168
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 221 - 264
Target Start/End: Complemental strand, 43271752 - 43271709
Alignment:
| Q |
221 |
tattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||||||||||||||| |||||| |||||| |||||||||||| |
|
|
| T |
43271752 |
tattatatgcagggaccagggttcgaaccccagacaccccactt |
43271709 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #169
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 186 - 264
Target Start/End: Original strand, 43596895 - 43596973
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaat-gcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||||||| || |||||||||||||| || |||| |||||||||||| ||||||||| |||||||||||| |||||| |
|
|
| T |
43596895 |
cccgtgagcttagctcagttggtagggatattgcat-attatatgcaggagccggggttcgaaccccggacactccactt |
43596973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #170
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 187 - 278
Target Start/End: Original strand, 45051592 - 45051683
Alignment:
| Q |
187 |
ccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||||| || |||||||||| |||| ||||||||||| |||| |||||||| || | |||| | ||||||||||||||||||| |
|
|
| T |
45051592 |
ccgtgagcataacttagttggtaggacaatccattattatatatagggttcggggttcgaatctaagacatctcacttattcaccttataag |
45051683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #171
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 224 - 263
Target Start/End: Original strand, 45617302 - 45617341
Alignment:
| Q |
224 |
tatatgcagggaccggggttctaaccccggacaccccact |
263 |
Q |
| |
|
||||||||||| ||||||||||||||||||||||| |||| |
|
|
| T |
45617302 |
tatatgcaggggccggggttctaaccccggacacctcact |
45617341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #172
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 186 - 264
Target Start/End: Original strand, 46105535 - 46105613
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaat-gcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||||||| || |||||||||||||| || |||| |||||||||||| ||||||||| |||||||||||| |||||| |
|
|
| T |
46105535 |
cccgtgagcttagctcagttggtagggatattgcat-attatatgcaggagccggggttcgaaccccggacactccactt |
46105613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #173
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 186 - 264
Target Start/End: Complemental strand, 46775100 - 46775022
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaat-gcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||||||| || |||||||||||||| || |||| |||||||||||| ||||||||| |||||||||||| |||||| |
|
|
| T |
46775100 |
cccgtgagcttagctcagttggtagggatattgcat-attatatgcaggagccggggttcgaaccccggacactccactt |
46775022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #174
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 186 - 264
Target Start/End: Complemental strand, 55251421 - 55251343
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaat-gcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||||||| || |||||||||||||| || |||| |||||||||||| ||||||||| |||||||||||| |||||| |
|
|
| T |
55251421 |
cccgtgagcttagctcagttggtagggatattgcat-attatatgcaggagccggggttcgaaccccggacactccactt |
55251343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #175
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 204 - 278
Target Start/End: Complemental strand, 6082951 - 6082877
Alignment:
| Q |
204 |
ttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||| | |||| ||||||||||||||||| ||| ||||| || |||| ||| |||| ||||||| |||||||| |
|
|
| T |
6082951 |
ttggtaagacaatacattattatatgcaggggccgtggttcgaatcccgaacatcccatttattcatcttataag |
6082877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #176
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 200 - 274
Target Start/End: Complemental strand, 6481668 - 6481594
Alignment:
| Q |
200 |
tcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctta |
274 |
Q |
| |
|
|||||||| |||| |||||| ||||||||||| | ||| ||||| |||| | ||| |||||||||||||||||| |
|
|
| T |
6481668 |
tcagttggcagggacatgcatgattatatgcagaggccgaggttcgaacctcagacgccccacttattcacctta |
6481594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #177
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 186 - 274
Target Start/End: Original strand, 9062173 - 9062263
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaa-ccccggacac-cccacttattcacctta |
274 |
Q |
| |
|
|||||||||||| | |||||| |||| ||||||||||||||||| || ||||||| || |||||||||| ||||||||||||||||| |
|
|
| T |
9062173 |
cccgtgagcatagtttagttggcagggacatgcattattatatgcaagggttggggttcgaacccccggacacacccacttattcacctta |
9062263 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #178
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 226 - 264
Target Start/End: Complemental strand, 11294868 - 11294830
Alignment:
| Q |
226 |
tatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
11294868 |
tatgcaggggccggggttcgaaccccggacaccccactt |
11294830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #179
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 184 - 273
Target Start/End: Complemental strand, 18741017 - 18740927
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggaca-ccccacttattcacctt |
273 |
Q |
| |
|
||||||| |||| | ||||||||| || | |||||||||||||||||||| ||| |||| |||||| ||| ||||||||||||||||| |
|
|
| T |
18741017 |
gtcccgtaagcacaactcagttggcagagatatgcattattatatgcaggggtcggagttcgaaccccaaacacccccacttattcacctt |
18740927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #180
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 26708651 - 26708601
Alignment:
| Q |
185 |
tcccgtgagcatacctcagttggtaggg-caatgcattattatatgcaggg |
234 |
Q |
| |
|
|||||||| ||| |||||||||||||| |||||||||||||||||||||| |
|
|
| T |
26708651 |
tcccgtgataataactcagttggtagggacaatgcattattatatgcaggg |
26708601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #181
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 228 - 274
Target Start/End: Complemental strand, 27862887 - 27862841
Alignment:
| Q |
228 |
tgcagggaccggggttctaaccccggacaccccacttattcacctta |
274 |
Q |
| |
|
||||||| | ||||||| |||||||||||||||||||||||| |||| |
|
|
| T |
27862887 |
tgcaggggctggggttcgaaccccggacaccccacttattcatctta |
27862841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #182
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 214 - 264
Target Start/End: Original strand, 28715719 - 28715768
Alignment:
| Q |
214 |
aatgcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
|||||||| |||||||||||| ||||||||| |||||||||||| |||||| |
|
|
| T |
28715719 |
aatgcatt-ttatatgcaggggccggggttcgaaccccggacactccactt |
28715768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #183
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 215 - 269
Target Start/End: Original strand, 30203279 - 30203333
Alignment:
| Q |
215 |
atgcattattatatgcagggaccggggttctaaccccggacaccccacttattca |
269 |
Q |
| |
|
||||||| |||||||||| | ||||||||| ||||||||| || ||||||||||| |
|
|
| T |
30203279 |
atgcattgttatatgcagaggccggggttcgaaccccggatactccacttattca |
30203333 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #184
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 199 - 264
Target Start/End: Original strand, 49056788 - 49056853
Alignment:
| Q |
199 |
ctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
|||||||||||||| || ||||| |||||||||||| |||| |||| ||||||||||||||||||| |
|
|
| T |
49056788 |
ctcagttggtagggacattgcat-attatatgcaggagccggagttcgaaccccggacaccccactt |
49056853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #185
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 228 - 274
Target Start/End: Original strand, 50815746 - 50815792
Alignment:
| Q |
228 |
tgcagggaccggggttctaaccccggacaccccacttattcacctta |
274 |
Q |
| |
|
||||||| ||||||||| ||||||||||||||||| |||||| |||| |
|
|
| T |
50815746 |
tgcaggggccggggttcgaaccccggacaccccacatattcatctta |
50815792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #186
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 199 - 264
Target Start/End: Complemental strand, 56088011 - 56087946
Alignment:
| Q |
199 |
ctcagttggtagggcaat-gcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
|||||||||||||| || ||||| |||||||||||| ||||||||| || |||||||||||||||| |
|
|
| T |
56088011 |
ctcagttggtagggatattgcatt-ttatatgcaggggccggggttcgaatcccggacaccccactt |
56087946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #187
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 223 - 273
Target Start/End: Original strand, 56555582 - 56555632
Alignment:
| Q |
223 |
ttatatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
|||||||||||| |||||||| |||| || |||||||||||||||||||| |
|
|
| T |
56555582 |
ttatatgcaggggtcggggttcgaacctcgaacaccccacttattcacctt |
56555632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #188
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 221 - 270
Target Start/End: Complemental strand, 9477471 - 9477422
Alignment:
| Q |
221 |
tattatatgcagggaccggggttctaaccccggacaccccacttattcac |
270 |
Q |
| |
|
||||||||||||||| || ||||| ||| || |||||||||||||||||| |
|
|
| T |
9477471 |
tattatatgcagggatcgtggttcaaactccagacaccccacttattcac |
9477422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #189
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 228 - 269
Target Start/End: Complemental strand, 11491275 - 11491234
Alignment:
| Q |
228 |
tgcagggaccggggttctaaccccggacaccccacttattca |
269 |
Q |
| |
|
||||||| |||| |||| |||||||||||||||||||||||| |
|
|
| T |
11491275 |
tgcaggggccggagttcgaaccccggacaccccacttattca |
11491234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #190
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 213 - 270
Target Start/End: Original strand, 11872897 - 11872954
Alignment:
| Q |
213 |
caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcac |
270 |
Q |
| |
|
||||||||||||||||| |||| ||| |||| ||||||||||| || |||||||||| |
|
|
| T |
11872897 |
caatgcattattatatgtaggggtcggagttcgaaccccggacatcctacttattcac |
11872954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #191
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 223 - 264
Target Start/End: Complemental strand, 17617013 - 17616972
Alignment:
| Q |
223 |
ttatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
|||||||||||| ||||||||| |||||||||||| |||||| |
|
|
| T |
17617013 |
ttatatgcaggggccggggttcgaaccccggacactccactt |
17616972 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #192
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 224 - 273
Target Start/End: Complemental strand, 21765469 - 21765420
Alignment:
| Q |
224 |
tatatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
||||||||||| || ||||| |||| ||||||||||||||||||||||| |
|
|
| T |
21765469 |
tatatgcaggggccaaggttcgaacctcggacaccccacttattcacctt |
21765420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #193
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 199 - 261
Target Start/End: Complemental strand, 23176779 - 23176716
Alignment:
| Q |
199 |
ctcagttggtagggc--aatgcattattatatgcagggaccggggttctaaccccggacacccca |
261 |
Q |
| |
|
|||||||||||||| |||||||| |||||||||||| |||||||| |||||||||||||||| |
|
|
| T |
23176779 |
ctcagttggtagggacaaatgcatt-ttatatgcaggggtcggggttcgaaccccggacacccca |
23176716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #194
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 222 - 267
Target Start/End: Complemental strand, 26885462 - 26885417
Alignment:
| Q |
222 |
attatatgcagggaccggggttctaaccccggacaccccacttatt |
267 |
Q |
| |
|
||||||||| ||| ||||||||| |||||||||||| ||||||||| |
|
|
| T |
26885462 |
attatatgctggggccggggttcgaaccccggacactccacttatt |
26885417 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #195
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 213 - 274
Target Start/End: Complemental strand, 29560078 - 29560017
Alignment:
| Q |
213 |
caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctta |
274 |
Q |
| |
|
||||||||| ||||||| ||||||||| |||| |||| ||||||| || |||||||||||| |
|
|
| T |
29560078 |
caatgcattgttatatgtagggaccggagttcgaacctcggacacaccgtttattcacctta |
29560017 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #196
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 190 - 274
Target Start/End: Original strand, 32124008 - 32124093
Alignment:
| Q |
190 |
tgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctta |
274 |
Q |
| |
|
|||||||| |||||||||||||| ||||| ||| |||| ||||||| || | |||| ||||| || ||| ||||||||||||||| |
|
|
| T |
32124008 |
tgagcataactcagttggtagggacaatgtattgttatgtgcaggggccagagttcaaacccgagagacctcacttattcacctta |
32124093 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #197
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 240 - 277
Target Start/End: Original strand, 43143771 - 43143808
Alignment:
| Q |
240 |
ggttctaaccccggacaccccacttattcaccttataa |
277 |
Q |
| |
|
||||| ||| |||||||||||||||||||||||||||| |
|
|
| T |
43143771 |
ggttcgaactccggacaccccacttattcaccttataa |
43143808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #198
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 224 - 269
Target Start/End: Complemental strand, 43362228 - 43362183
Alignment:
| Q |
224 |
tatatgcagggaccggggttctaaccccggacaccccacttattca |
269 |
Q |
| |
|
||||| ||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
43362228 |
tatattcaggggtcggggttcgaaccccggacaccccacttattca |
43362183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #199
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 236 - 269
Target Start/End: Original strand, 46283169 - 46283202
Alignment:
| Q |
236 |
ccggggttctaaccccggacaccccacttattca |
269 |
Q |
| |
|
||||||||| |||||||||||||||||||||||| |
|
|
| T |
46283169 |
ccggggttcgaaccccggacaccccacttattca |
46283202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #200
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 223 - 264
Target Start/End: Original strand, 55531291 - 55531332
Alignment:
| Q |
223 |
ttatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
|||||||||||| ||||||||| |||||||||||| |||||| |
|
|
| T |
55531291 |
ttatatgcaggggccggggttcaaaccccggacactccactt |
55531332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #201
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 185 - 264
Target Start/End: Original strand, 624479 - 624558
Alignment:
| Q |
185 |
tcccgtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
|||||||||| || ||||||||||| || || ||||| ||| ||||||||| | ||||||| |||||| |||||||||||| |
|
|
| T |
624479 |
tcccgtgagcttaactcagttggtaaggacattgcataatt-tatgcaggggcaggggttcgaacccctgacaccccactt |
624558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #202
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 221 - 261
Target Start/End: Complemental strand, 8848247 - 8848207
Alignment:
| Q |
221 |
tattatatgcagggaccggggttctaaccccggacacccca |
261 |
Q |
| |
|
|||||||| ||||| ||||||||| |||||||||||||||| |
|
|
| T |
8848247 |
tattatatacaggggccggggttcgaaccccggacacccca |
8848207 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #203
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 186 - 257
Target Start/End: Original strand, 9761115 - 9761186
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacac |
257 |
Q |
| |
|
||||||||| ||||||||||||||||| | |||| ||||||||||||| | ||||||| |||||||||||| |
|
|
| T |
9761115 |
cccgtgagcttacctcagttggtagggatattgca-tattatatgcaggagctggggttcgaaccccggacac |
9761186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #204
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 215 - 267
Target Start/End: Complemental strand, 14504702 - 14504650
Alignment:
| Q |
215 |
atgcattattatatgcagggaccggggttctaaccccggacaccccacttatt |
267 |
Q |
| |
|
||||||| |||||||||||| |||| ||| |||| ||||||||||||||||| |
|
|
| T |
14504702 |
atgcattgttatatgcaggggccggaattcgaacctcggacaccccacttatt |
14504650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #205
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 187 - 267
Target Start/End: Original strand, 15853820 - 15853900
Alignment:
| Q |
187 |
ccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttatt |
267 |
Q |
| |
|
||||||||||| |||||||| ||| ||||||| |||||| ||||| | ||||||| ||||| |||||||||| ||||| |
|
|
| T |
15853820 |
ccgtgagcataattcagttggcaggaacatgcattgttatatacaggggctggggttcgaaccctggacaccccagttatt |
15853900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #206
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 185 - 264
Target Start/End: Complemental strand, 22788745 - 22788666
Alignment:
| Q |
185 |
tcccgtgagcatacctcagttggtagggcaat-gcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
|||||||||| || |||||||||||||| || |||| ||||||||||||| ||| |||| || |||||||||||||||| |
|
|
| T |
22788745 |
tcccgtgagcttagctcagttggtagggatattgcat-attatatgcaggggccgaggtttgaatcccggacaccccactt |
22788666 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #207
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 238 - 274
Target Start/End: Original strand, 30295562 - 30295598
Alignment:
| Q |
238 |
ggggttctaaccccggacaccccacttattcacctta |
274 |
Q |
| |
|
||||||| |||||| |||||||||||||||||||||| |
|
|
| T |
30295562 |
ggggttcgaaccccagacaccccacttattcacctta |
30295598 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #208
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 238 - 274
Target Start/End: Original strand, 30324464 - 30324500
Alignment:
| Q |
238 |
ggggttctaaccccggacaccccacttattcacctta |
274 |
Q |
| |
|
||||||| |||||| |||||||||||||||||||||| |
|
|
| T |
30324464 |
ggggttcgaaccccagacaccccacttattcacctta |
30324500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #209
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 226 - 270
Target Start/End: Original strand, 40486481 - 40486525
Alignment:
| Q |
226 |
tatgcagggaccggggttctaaccccggacaccccacttattcac |
270 |
Q |
| |
|
||||||||| ||||||||| |||||||||||| |||||| ||||| |
|
|
| T |
40486481 |
tatgcaggggccggggttcgaaccccggacactccacttcttcac |
40486525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #210
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 246 - 278
Target Start/End: Original strand, 41943964 - 41943996
Alignment:
| Q |
246 |
aaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| |
|
|
| T |
41943964 |
aaccccggacaccctacttattcaccttataag |
41943996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #211
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 199 - 267
Target Start/End: Original strand, 42432018 - 42432086
Alignment:
| Q |
199 |
ctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttatt |
267 |
Q |
| |
|
||||||||| |||| ||||||| ||||||||||||| ||||||| ||| ||| |||||| ||||||| |
|
|
| T |
42432018 |
ctcagttggcagggacatgcattgttatatgcagggattggggttcgaactccgaacaccctacttatt |
42432086 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #212
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 221 - 273
Target Start/End: Complemental strand, 44315565 - 44315513
Alignment:
| Q |
221 |
tattatatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
||||||||||||| ||||| ||| ||||||| |||||||| ||||||||||| |
|
|
| T |
44315565 |
tattatatgcaggagccgggattcaaaccccgaacaccccatttattcacctt |
44315513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #213
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 202 - 274
Target Start/End: Original strand, 45011390 - 45011462
Alignment:
| Q |
202 |
agttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctta |
274 |
Q |
| |
|
||||||||||| ||||||||||||||| |||| | |||||| |||| | |||| |||||||||||||||| |
|
|
| T |
45011390 |
agttggtagggatatgcattattatatgtaggggtccgggttcaaaccacagacaatccacttattcacctta |
45011462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #214
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 249 - 277
Target Start/End: Complemental strand, 45372778 - 45372750
Alignment:
| Q |
249 |
cccggacaccccacttattcaccttataa |
277 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
45372778 |
cccggacaccccacttattcaccttataa |
45372750 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #215
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 185 - 264
Target Start/End: Complemental strand, 48615543 - 48615464
Alignment:
| Q |
185 |
tcccgtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||||||||||| |||||||||||||| | |||| |||||||||||| ||||||||| ||||||||| || |||||| |
|
|
| T |
48615543 |
tcccgtgagcataactcagttggtagggatattgca-tattatatgcagaagccggggttcgaaccccggatactccactt |
48615464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #216
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 185 - 264
Target Start/End: Complemental strand, 50457785 - 50457706
Alignment:
| Q |
185 |
tcccgtgagcatacctcagttggtagggcaat-gcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
|||||||||| || ||||||||||| || || |||| ||||||||||||| || |||||| |||||||||||| |||||| |
|
|
| T |
50457785 |
tcccgtgagcttagctcagttggtaaggatattgcat-attatatgcaggggccagggttcgaaccccggacactccactt |
50457706 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #217
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 225 - 273
Target Start/End: Original strand, 53468732 - 53468780
Alignment:
| Q |
225 |
atatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
||||||| || ||||||||| |||||||||||||| ||||||| ||||| |
|
|
| T |
53468732 |
atatgcaagggccggggttcgaaccccggacaccctacttatttacctt |
53468780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4; HSP #218
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 190 - 234
Target Start/End: Original strand, 55345765 - 55345809
Alignment:
| Q |
190 |
tgagcatacctcagttggtagggcaatgcattattatatgcaggg |
234 |
Q |
| |
|
|||||||| ||||||||||||| |||||| ||||||||| ||||| |
|
|
| T |
55345765 |
tgagcatagctcagttggtaggacaatgcgttattatatacaggg |
55345809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2 (Bit Score: 80; Significance: 1e-37; HSPs: 152)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 80; E-Value: 1e-37
Query Start/End: Original strand, 183 - 278
Target Start/End: Complemental strand, 580884 - 580789
Alignment:
| Q |
183 |
tgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||||||||| ||||||||||||| |||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
580884 |
tgtcccgtgagcatagctcagttggtaggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttattcaccttataag |
580789 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 78; E-Value: 2e-36
Query Start/End: Original strand, 181 - 278
Target Start/End: Original strand, 17154641 - 17154738
Alignment:
| Q |
181 |
aatgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||||||||||| ||| ||||||||| |||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
17154641 |
aatgtcccgtgagcataactcggttggtaggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttattcaccttataag |
17154738 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 72; E-Value: 9e-33
Query Start/End: Original strand, 183 - 278
Target Start/End: Complemental strand, 8234893 - 8234798
Alignment:
| Q |
183 |
tgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||||||||| ||||||||||||| |||| |||||||||||| |||| ||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
8234893 |
tgtcccgtgagcatagctcagttggtaggacaatacattattatatgtaggggccggggttcgaaccccggacaccccacttattcaccttataag |
8234798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #4
Raw Score: 72; E-Value: 9e-33
Query Start/End: Original strand, 183 - 278
Target Start/End: Complemental strand, 30474296 - 30474201
Alignment:
| Q |
183 |
tgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||||||||| ||||||||||||| |||||||||||||||||||||| ||| ||||| |||||| |||||||||||||||||||||||||| |
|
|
| T |
30474296 |
tgtcccgtgagcatagctcagttggtaggacaatgcattattatatgcaggggccgaggttcgaaccccagacaccccacttattcaccttataag |
30474201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #5
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 184 - 278
Target Start/End: Original strand, 7086248 - 7086342
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||||||| |||||||||||||||||||||||||||||||||||| ||||| ||| ||||||| |||||||| |||||||||||||||| |
|
|
| T |
7086248 |
gtcccgtgagcatagctcagttggtagggcaatgcattattatatgcaggggccgggattcgaaccccgaacaccccaattattcaccttataag |
7086342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #6
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 184 - 277
Target Start/End: Original strand, 10262734 - 10262827
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataa |
277 |
Q |
| |
|
|||||||||||||| ||||||||||||| |||||||||||||||||||||| |||||||| |||||| ||||||||||||||||||||||||| |
|
|
| T |
10262734 |
gtcccgtgagcataactcagttggtaggacaatgcattattatatgcaggggtcggggttcgaaccccagacaccccacttattcaccttataa |
10262827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #7
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 186 - 278
Target Start/End: Original strand, 11133072 - 11133165
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||||| |||||||||||||| ||||||||| |||||||||||| |||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
11133072 |
cccgtgagcatagctcagttggtagggacaatgcattgttatatgcaggggtcggggttcgaaccccggacaccccacttattcaccttataag |
11133165 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #8
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 185 - 278
Target Start/End: Complemental strand, 20122574 - 20122481
Alignment:
| Q |
185 |
tcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||||||| ||||||||||||| ||||||||||||||||| |||| ||||||||| |||||||||||| ||||||||||| |||||||| |
|
|
| T |
20122574 |
tcccgtgagcatagctcagttggtaggacaatgcattattatatgtaggggccggggttcgaaccccggacacgccacttattcatcttataag |
20122481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #9
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 188 - 277
Target Start/End: Complemental strand, 22297548 - 22297459
Alignment:
| Q |
188 |
cgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataa |
277 |
Q |
| |
|
|||||||||| ||||||||||||| |||||||||||||||||||||| | ||||||| |||||||||||||||| ||||||||||||||| |
|
|
| T |
22297548 |
cgtgagcatagctcagttggtaggacaatgcattattatatgcaggggcaggggttcgaaccccggacaccccatttattcaccttataa |
22297459 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #10
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 186 - 281
Target Start/End: Original strand, 29034972 - 29035068
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataagtga |
281 |
Q |
| |
|
|||||||||||| |||| |||| |||| |||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||| ||| |||||| |
|
|
| T |
29034972 |
cccgtgagcatagctcacttggcagggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttattcactttaaaagtga |
29035068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #11
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 183 - 271
Target Start/End: Complemental strand, 36520881 - 36520793
Alignment:
| Q |
183 |
tgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacc |
271 |
Q |
| |
|
|||||||||||| || ||||||||||||| ||||||||||||||||| |||| |||||||| |||||||||||||||||||||||||| |
|
|
| T |
36520881 |
tgtcccgtgagcgtagctcagttggtaggacaatgcattattatatgtaggggtcggggttcgaaccccggacaccccacttattcacc |
36520793 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #12
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 183 - 278
Target Start/End: Complemental strand, 2114536 - 2114441
Alignment:
| Q |
183 |
tgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||||||||| |||||||||||| ||||||||||||||||| |||| |||||||| ||||||||||||| || |||||||||||||||| |
|
|
| T |
2114536 |
tgtcccgtgagcatagctcagttggtagaacaatgcattattatatgtaggggtcggggttcgaaccccggacacctcatttattcaccttataag |
2114441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #13
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 183 - 278
Target Start/End: Original strand, 3179318 - 3179413
Alignment:
| Q |
183 |
tgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||||||||| |||||||||||| |||||||||||||||||||||| || ||||| |||| | |||||||||||||||||||||||||| |
|
|
| T |
3179318 |
tgtcccgtgagcataactcagttggtagaacaatgcattattatatgcaggggtcgaggttcgaacctcagacaccccacttattcaccttataag |
3179413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #14
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 183 - 278
Target Start/End: Complemental strand, 33001654 - 33001559
Alignment:
| Q |
183 |
tgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||||||||| ||||||||||||| |||||| |||||||||||| || |||||||| || ||||||||||||||||||||| |||||||| |
|
|
| T |
33001654 |
tgtcccgtgagcataactcagttggtaggacaatgcgttattatatgcaagggccggggtttgaatcccggacaccccacttattcatcttataag |
33001559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #15
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 184 - 278
Target Start/End: Original strand, 1836583 - 1836677
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||||| || ||||||||||||| ||||||||||||||||| ||| | |||||||| |||||||||||||| ||||||||||| |||||| |
|
|
| T |
1836583 |
gtcccgtgagcctagctcagttggtaggacaatgcattattatatgaaggaatcggggttcgaaccccggacaccctacttattcaccatataag |
1836677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #16
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 186 - 281
Target Start/End: Original strand, 34034347 - 34034442
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataagtga |
281 |
Q |
| |
|
|||||||||||| ||||||||| |||| |||| |||||||||||||||| |||||||||| ||||||||||||||||||||||||| ||| |||||| |
|
|
| T |
34034347 |
cccgtgagcatagctcagttggcagggacaatacattattatatgcagg-accggggttcgaaccccggacaccccacttattcactttaaaagtga |
34034442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #17
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 192 - 278
Target Start/End: Complemental strand, 3037715 - 3037628
Alignment:
| Q |
192 |
agcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||| ||||||||| ||| ||||||||| |||||||||||| ||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
3037715 |
agcataactcagttggctgggacaatgcattgttatatgcaggggccggggttcgaaccccggacaccccacttattcaccttataag |
3037628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #18
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 183 - 278
Target Start/End: Complemental strand, 9547228 - 9547133
Alignment:
| Q |
183 |
tgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||| |||| |||||||| |||| ||||| |||||||||||||||| ||||||||| || |||| |||||||||||||||| |||||||| |
|
|
| T |
9547228 |
tgtcccgtgaacatagctcagttgataggacaatgtattattatatgcaggggccggggttcgaatcccgaacaccccacttattcatcttataag |
9547133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #19
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 184 - 278
Target Start/End: Original strand, 31564090 - 31564178
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||||||| ||||||||||||| ||||||||||||||||||| ||||||| ||||||||| ||||||||||||||||||||||| |
|
|
| T |
31564090 |
gtcccgtgagcataactcagttggtaggacaatgcattattatatgca------ggggttcgaaccccggaaaccccacttattcaccttataag |
31564178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #20
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 187 - 278
Target Start/End: Original strand, 36665428 - 36665519
Alignment:
| Q |
187 |
ccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||| ||| ||||||| ||||| |||||||||||||||||||||| ||||||||| |||| ||||||||||||||||||| ||||||| |
|
|
| T |
36665428 |
ccgtgagtatagctcagtttgtaggacaatgcattattatatgcaggggccggggttcgaacctcggacaccccacttattcattttataag |
36665519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #21
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 187 - 278
Target Start/End: Original strand, 44422105 - 44422196
Alignment:
| Q |
187 |
ccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||| || | |||||||| ||||||||||||||||||||||| ||| |||| ||||||||||||||||||||||||| ||||||| |
|
|
| T |
44422105 |
ccgtgagcatggcttatttggtaggacaatgcattattatatgcagggatcggagttcgaaccccggacaccccacttattcactttataag |
44422196 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #22
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 184 - 278
Target Start/End: Original strand, 17239896 - 17239990
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||| |||||||| |||||||||||| |||||||||||||||||||||| |||| ||| |||| ||||||||||||||||||| |||||||| |
|
|
| T |
17239896 |
gtcccatgagcatagctcagttggtagaacaatgcattattatatgcaggggtcgggattcgaacctcggacaccccacttattcatcttataag |
17239990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #23
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 184 - 278
Target Start/End: Original strand, 22538534 - 22538628
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||||| || ||||||||||||| |||||||||||||||||||||| ||||||| || |||| ||||| ||||||||||||||||||| |
|
|
| T |
22538534 |
gtcccgtgagcctaactcagttggtaggacaatgcattattatatgcaggggttggggttcgaatcccgaacacctcacttattcaccttataag |
22538628 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #24
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 194 - 278
Target Start/End: Complemental strand, 18386902 - 18386818
Alignment:
| Q |
194 |
catacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||| |||| |||||||| ||||||||||||||||| |||| | ||||||| ||| ||||||||||||||||||||||||||||| |
|
|
| T |
18386902 |
catagctcaattggtaggacaatgcattattatatgtaggggctggggttcgaactccggacaccccacttattcaccttataag |
18386818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #25
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 186 - 281
Target Start/End: Complemental strand, 21970538 - 21970442
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataagtga |
281 |
Q |
| |
|
|||||||||||| |||||||| |||| ||||||||||||||||||||||| |||||||| ||||||||| ||||| ||||||||| ||| |||||| |
|
|
| T |
21970538 |
cccgtgagcatagctcagttgacagggacaatgcattattatatgcagggatcggggttcgaaccccggataccccgcttattcactttaaaagtga |
21970442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #26
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 194 - 278
Target Start/End: Original strand, 32891286 - 32891370
Alignment:
| Q |
194 |
catacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||| ||||||||||||| |||||||||||||||||||||| ||| ||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
32891286 |
catagctcagttggtaggacaatgcattattatatgcaggggtcggttttcgaaccccggacaccccacttattcatcttataag |
32891370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #27
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 188 - 271
Target Start/End: Original strand, 41699101 - 41699184
Alignment:
| Q |
188 |
cgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacc |
271 |
Q |
| |
|
|||||||||| ||||||||||||| | ||||||||||||||||||| |||||||| ||||||| |||||||||||||||||| |
|
|
| T |
41699101 |
cgtgagcataactcagttggtaggatattgcattattatatgcaggggtcggggttcgaaccccgaacaccccacttattcacc |
41699184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #28
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 199 - 278
Target Start/End: Complemental strand, 44721789 - 44721710
Alignment:
| Q |
199 |
ctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| |||||||| |||| ||||||||||| |||||||||||||||| |
|
|
| T |
44721789 |
ctcagttggtagaacaatgcattattatatgcaggggtcggggttcgaacctcggacaccccatttattcaccttataag |
44721710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #29
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 188 - 278
Target Start/End: Original strand, 9796897 - 9796986
Alignment:
| Q |
188 |
cgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||| |||| |||||||| | || |||||||||||||||||||||| |||||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
9796897 |
cgtgaccatagctcagttgat-ggacaatgcattattatatgcaggggtcggggttcgaaccccggacaccccacttattcatcttataag |
9796986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #30
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 184 - 278
Target Start/End: Complemental strand, 15392311 - 15392217
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||||||| ||||||||||||| ||||||||||||||||| ||| || ||||| |||| |||||||| ||||||||||| ||||||| |
|
|
| T |
15392311 |
gtcccgtgagcataactcagttggtaggacaatgcattattatatgtaggagacgaggttcgaacctcggacacctcacttattcactttataag |
15392217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #31
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 184 - 278
Target Start/End: Original strand, 16973903 - 16973997
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||||||| ||||||| ||||| ||||| |||||||||||||||| || ||| |||||||||||||||||||||| |||||||||| |
|
|
| T |
16973903 |
gtcccgtgagcatagctcagtttgtaggacaatggattattatatgcaggggttaggattcgaaccccggacaccccacttatttaccttataag |
16973997 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #32
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 187 - 265
Target Start/End: Complemental strand, 26807181 - 26807103
Alignment:
| Q |
187 |
ccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccactta |
265 |
Q |
| |
|
||||||||||| ||||||||||||| |||||||||||||||||||||| || |||||| |||||| | ||||||||||| |
|
|
| T |
26807181 |
ccgtgagcataactcagttggtaggacaatgcattattatatgcaggggccagggttcgaaccccaggcaccccactta |
26807103 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #33
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 181 - 278
Target Start/End: Complemental strand, 11190202 - 11190105
Alignment:
| Q |
181 |
aatgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||||||||||| |||| || |||| ||||||||||||||||||||| ||||||||| || || ||||||| |||||||||||||||||| |
|
|
| T |
11190202 |
aatgtcccgtgagcatagctcaattcgtagaccaatgcattattatatgcaggagccggggttcaaattccagacaccctacttattcaccttataag |
11190105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #34
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 186 - 278
Target Start/End: Original strand, 29664599 - 29664692
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||||| |||| |||| |||| ||||||||| |||||||||||| |||||||| || ||||||||||||||||||||| |||||||| |
|
|
| T |
29664599 |
cccgtgagcatagctcaattggcagggacaatgcattgttatatgcaggggtcggggttcaaatcccggacaccccacttattcatcttataag |
29664692 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #35
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 185 - 281
Target Start/End: Complemental strand, 32527177 - 32527080
Alignment:
| Q |
185 |
tcccgtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataagtga |
281 |
Q |
| |
|
|||||| | |||| ||||||||| |||| |||||||||||||||||||||| ||||||||| |||||| |||| ||||||||||||| ||| |||||| |
|
|
| T |
32527177 |
tcccgtaaacatagctcagttggcagggacaatgcattattatatgcaggggccggggttcgaaccccagacaacccacttattcactttaaaagtga |
32527080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #36
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 186 - 274
Target Start/End: Complemental strand, 44487865 - 44487777
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctta |
274 |
Q |
| |
|
|||||||| ||| |||||||| ||||| ||||||||||||||||| || |||| |||| ||||||||||| ||||||||||||||||| |
|
|
| T |
44487865 |
cccgtgagtatagctcagttgatagggacatgcattattatatgcaagggccggagttcgaaccccggacatcccacttattcacctta |
44487777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #37
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 187 - 281
Target Start/End: Original strand, 44187701 - 44187796
Alignment:
| Q |
187 |
ccgtgagcatacctcagttggtagggc-aatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataagtga |
281 |
Q |
| |
|
||||||||||| |||||||| |||| ||||||||||||||||||||| |||||||| |||||| |||||||||||||||||| ||| |||||| |
|
|
| T |
44187701 |
ccgtgagcatagttcagttggcagggataatgcattattatatgcaggggtcggggttcgaaccccagacaccccacttattcactttaaaagtga |
44187796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #38
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 204 - 278
Target Start/End: Complemental strand, 19905735 - 19905661
Alignment:
| Q |
204 |
ttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||| || |||||||||||||||| ||||| |||||||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
19905735 |
ttggttggacaatgcattattatatacaggggtcggggttcgaaccccggacacccgacttattcaccttataag |
19905661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #39
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 192 - 270
Target Start/End: Complemental strand, 24034145 - 24034067
Alignment:
| Q |
192 |
agcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcac |
270 |
Q |
| |
|
|||||| || |||||||||| |||||||||||||||||||||| |||||||| |||| ||||||| |||||||||||| |
|
|
| T |
24034145 |
agcatagcttagttggtaggacaatgcattattatatgcaggggtcggggttcgaacctcggacactccacttattcac |
24034067 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #40
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 199 - 277
Target Start/End: Original strand, 32943349 - 32943427
Alignment:
| Q |
199 |
ctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataa |
277 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| | | ||||||| || ||||||||||||||||||||||||||| |
|
|
| T |
32943349 |
ctcagttggtaggacaatgcattattatatgcagaggctggggttcgaatttcggacaccccacttattcaccttataa |
32943427 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #41
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 189 - 278
Target Start/End: Complemental strand, 16028203 - 16028114
Alignment:
| Q |
189 |
gtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||| ||| ||||||||||||| |||||||||||||||||||| | |||||||| ||| || |||| ||||||||||||| ||||||| |
|
|
| T |
16028203 |
gtgagtataactcagttggtaggacaatgcattattatatgcagtggtcggggttcgaactccagacatcccacttattcactttataag |
16028114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #42
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 204 - 281
Target Start/End: Complemental strand, 19052691 - 19052614
Alignment:
| Q |
204 |
ttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataagtga |
281 |
Q |
| |
|
|||||||| |||||||||||||||||||||| | || ||| ||||||||||| |||||||||||| ||||||||||| |
|
|
| T |
19052691 |
ttggtaggacaatgcattattatatgcaggggtcaggattcgaaccccggacatcccacttattcatcttataagtga |
19052614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #43
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 190 - 278
Target Start/End: Original strand, 31956867 - 31956956
Alignment:
| Q |
190 |
tgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggaca-ccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||| ||||||||||||| ||||||||||||||||| |||| | ||||||| ||| ||| ||| |||||||||||||| ||||||| |
|
|
| T |
31956867 |
tgagcataactcagttggtaggacaatgcattattatatgtaggggctggggttcgaactccgaacacccccacttattcacgttataag |
31956956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #44
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 189 - 278
Target Start/End: Complemental strand, 36426951 - 36426862
Alignment:
| Q |
189 |
gtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||| |||| |||||||| ||||||||||||||||| |||| ||||||| ||| ||| |||||||||||||||| |||||||| |
|
|
| T |
36426951 |
gtgagcatagctcacttggtaggacaatgcattattatatgtaggggttggggttcgaactccgaacaccccacttattcatcttataag |
36426862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #45
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 186 - 281
Target Start/End: Original strand, 2304286 - 2304382
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataagtga |
281 |
Q |
| |
|
||||||||| || ||||||||| |||| ||||| ||||||||||| |||| |||||||| |||||||||||||||||||||| || ||| |||||| |
|
|
| T |
2304286 |
cccgtgagcttagctcagttggcagggacaatgtattattatatgtaggggtcggggttcgaaccccggacaccccacttatttactttaaaagtga |
2304382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #46
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 193 - 277
Target Start/End: Original strand, 11727337 - 11727421
Alignment:
| Q |
193 |
gcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataa |
277 |
Q |
| |
|
||||| || |||||| ||| ||||| ||||||||||| ||||||||| |||| |||||| |||||||||||||||||||||||| |
|
|
| T |
11727337 |
gcatagctgagttggcaggacaatgtattattatatgtagggaccggagttcgaaccccaaacaccccacttattcaccttataa |
11727421 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #47
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 185 - 277
Target Start/End: Original strand, 32988346 - 32988438
Alignment:
| Q |
185 |
tcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataa |
277 |
Q |
| |
|
||||||||||||| ||||||||||| | ||||||||||||||| |||||| | ||||||| ||| || ||||||||||||||| | |||||| |
|
|
| T |
32988346 |
tcccgtgagcatagctcagttggtaagacaatgcattattatacgcaggggctggggttcgaacatcgaacaccccacttattctctttataa |
32988438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #48
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 213 - 281
Target Start/End: Original strand, 43870977 - 43871045
Alignment:
| Q |
213 |
caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataagtga |
281 |
Q |
| |
|
||||||||||||||||||||| ||||||||| || |||||||||||||||||||||| ||| |||||| |
|
|
| T |
43870977 |
caatgcattattatatgcaggagccggggttcgaatcccggacaccccacttattcactttaaaagtga |
43871045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #49
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 188 - 267
Target Start/End: Original strand, 9802892 - 9802970
Alignment:
| Q |
188 |
cgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttatt |
267 |
Q |
| |
|
|||||||||| |||||||| | || ||||||||||||||||||| || |||||||| |||||||||||||||||||||| |
|
|
| T |
9802892 |
cgtgagcatagctcagttgat-ggacaatgcattattatatgcaagggtcggggttcgaaccccggacaccccacttatt |
9802970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #50
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 187 - 278
Target Start/End: Original strand, 10207643 - 10207734
Alignment:
| Q |
187 |
ccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||||| ||||||||||||| ||||||||||||||||||| | ||| ||| ||| |||||||| ||||||||||||||||||| |
|
|
| T |
10207643 |
ccgtgagcatagctcagttggtaggataatgcattattatatgcagtggtcggagtttgaactccggacacttcacttattcaccttataag |
10207734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #51
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 187 - 270
Target Start/End: Complemental strand, 14307791 - 14307708
Alignment:
| Q |
187 |
ccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcac |
270 |
Q |
| |
|
|||||||||| |||||||||||||| ||||||| |||||||||||| || ||||| ||||||| ||||||||||||||||| |
|
|
| T |
14307791 |
ccgtgagcatggctcagttggtagggacatgcattgttatatgcaggggtcgaggttcgaaccccgaacaccccacttattcac |
14307708 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #52
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 185 - 278
Target Start/End: Original strand, 2935812 - 2935906
Alignment:
| Q |
185 |
tcccgtgagcatacctcagttggtagg-gcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||||||| ||||||||| ||| ||||||||| |||||||| ||| |||| |||| |||| |||||||||| ||||||||| ||||||| |
|
|
| T |
2935812 |
tcccgtgagcatagctcagttggcaggaacaatgcattgttatatgcgggggccggagttcgaacctcggacaccccgcttattcactttataag |
2935906 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #53
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 188 - 278
Target Start/End: Complemental strand, 9791991 - 9791901
Alignment:
| Q |
188 |
cgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||| |||||||||||| ||||||||||||||||| ||| |||||||| || | |||||||||||||||||| |||||||| |
|
|
| T |
9791991 |
cgtgagcatagttcagttggtaggacaatgcattattatatgtaggtgtcggggttcgaattctggacaccccacttattcatcttataag |
9791901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #54
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 215 - 273
Target Start/End: Original strand, 32288402 - 32288460
Alignment:
| Q |
215 |
atgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
||||||||||||||| ||||| |||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
32288402 |
atgcattattatatgtagggatcggggttcgaacctcggacaccccacttattcacctt |
32288460 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #55
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 184 - 270
Target Start/End: Original strand, 43200835 - 43200921
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcac |
270 |
Q |
| |
|
|||| |||| |||| |||||||||||| |||| |||||||||||||||| |||| |||| ||||||| ||||||||||||||||| |
|
|
| T |
43200835 |
gtccagtgaacatagctcagttggtagaacaatatattattatatgcaggggccggagttcgaaccccgaacaccccacttattcac |
43200921 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #56
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 185 - 278
Target Start/End: Complemental strand, 17115643 - 17115550
Alignment:
| Q |
185 |
tcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||||||| ||||||||||||| || || ||||||||||||| | ||| |||| ||||||||||| |||| |||||||| ||||||| |
|
|
| T |
17115643 |
tcccgtgagcatagctcagttggtaggacactgtattattatatgcaaaggtcggagttcgaaccccggacatcccatttattcactttataag |
17115550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #57
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 185 - 278
Target Start/End: Original strand, 20533753 - 20533846
Alignment:
| Q |
185 |
tcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||| |||||||| |||||||||||| ||| ||||||||||||||| || || ||||| |||||| ||| ||||||||||||||||||||| |
|
|
| T |
20533753 |
tcccatgagcatagctcagttggtagaacaaaacattattatatgcagagatcgaggttcgaaccccacacatcccacttattcaccttataag |
20533846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #58
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 186 - 274
Target Start/End: Original strand, 23405196 - 23405284
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctta |
274 |
Q |
| |
|
||||||||| || |||||||||||||| || ||||| || |||||||||| |||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
23405196 |
cccgtgagcttagctcagttggtagggacattgcataat-atatgcaggggtcggggttcgaaccctggacaccccacttattcacctta |
23405284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #59
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 185 - 270
Target Start/End: Complemental strand, 39334980 - 39334895
Alignment:
| Q |
185 |
tcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcac |
270 |
Q |
| |
|
||||||||||||| ||||||||| |||| |||||||||||||| ||||| | ||||||| ||| || |||| ||||||||||||| |
|
|
| T |
39334980 |
tcccgtgagcataactcagttggcagggacatgcattattatatacaggggctggggttcgaactccagacatcccacttattcac |
39334895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #60
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 202 - 270
Target Start/End: Complemental strand, 4157731 - 4157663
Alignment:
| Q |
202 |
agttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcac |
270 |
Q |
| |
|
|||||||||| ||||||||||||||||| ||| | || |||| ||||||||||||||||||||||||| |
|
|
| T |
4157731 |
agttggtaggacaatgcattattatatgtaggtgctggagttcgaaccccggacaccccacttattcac |
4157663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #61
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 189 - 273
Target Start/End: Complemental strand, 5029195 - 5029111
Alignment:
| Q |
189 |
gtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
||||||||| ||||||||||||| |||||||||||||||||| | |||| |||| || | || |||||||||||||||||||| |
|
|
| T |
5029195 |
gtgagcatagctcagttggtaggtatatgcattattatatgcagaggccggagttcgaatctcgaacaccccacttattcacctt |
5029111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #62
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 184 - 278
Target Start/End: Complemental strand, 15690134 - 15690038
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgca-gggaccggggttctaaccccg-gacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||||||| ||||||||||||| ||||||||| ||||||||| ||||| ||||||| |||| | || |||||||||||||| ||||||| |
|
|
| T |
15690134 |
gtcccgtgagcatagctcagttggtaggacaatgcattgttatatgcaggggacgggggttcgaacctagacaccccccacttattcactttataag |
15690038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #63
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 184 - 272
Target Start/End: Complemental strand, 25050340 - 25050252
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacct |
272 |
Q |
| |
|
|||| ||||||||| ||||||||||||| ||||||||||||||||||||| |||| ||| |||||| ||||| | |||||| ||||| |
|
|
| T |
25050340 |
gtccagtgagcatagctcagttggtaggataatgcattattatatgcaggggtcgggattcgaaccccagacacacaacttatccacct |
25050252 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #64
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 186 - 264
Target Start/End: Complemental strand, 33229003 - 33228925
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaat-gcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||||||| || |||||||||||||| || |||| ||||||||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
33229003 |
cccgtgagcttagctcagttggtagggatattgcat-attatatgcaggggccggggttcgaaccccggacaccccactt |
33228925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #65
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 191 - 274
Target Start/End: Complemental strand, 42091367 - 42091285
Alignment:
| Q |
191 |
gagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctta |
274 |
Q |
| |
|
||||||| ||||||||||||| |||||||||||||||| |||| |||| |||| || |||| ||| ||||||||||||||||| |
|
|
| T |
42091367 |
gagcataactcagttggtaggacaatgcattattatattcaggagccggagttcgaa-cccgaacaacccacttattcacctta |
42091285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #66
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 188 - 278
Target Start/End: Original strand, 34620517 - 34620607
Alignment:
| Q |
188 |
cgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||| ||| ||||||||| ||||||||||||||||||| || |||||| |||||| ||||| | | |||||||||||||||| |
|
|
| T |
34620517 |
cgtgagcatagctcggttggtaggacaatgcattattatatgcaagggttggggtttgaaccccagacactctatttattcaccttataag |
34620607 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #67
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 187 - 277
Target Start/End: Original strand, 36481067 - 36481157
Alignment:
| Q |
187 |
ccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataa |
277 |
Q |
| |
|
||||||||||| ||||||||||||| ||||||||||||||||||| || | || |||| |||||| ||||| | ||||||| ||||||| |
|
|
| T |
36481067 |
ccgtgagcatagctcagttggtaggacaatgcattattatatgcatgggctggagttcgaaccccaaacaccataattattcatcttataa |
36481157 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #68
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 185 - 270
Target Start/End: Complemental strand, 38530294 - 38530208
Alignment:
| Q |
185 |
tcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggac-cggggttctaaccccggacaccccacttattcac |
270 |
Q |
| |
|
|||||| ||| || ||||||||||||| |||||||||||||||| ||||| | ||||||| ||| |||||||||||||||||||| |
|
|
| T |
38530294 |
tcccgtaagcttagctcagttggtaggacaatgcattattatatacaggggcttggggttcgaactgcggacaccccacttattcac |
38530208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #69
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 200 - 278
Target Start/End: Original strand, 45523676 - 45523754
Alignment:
| Q |
200 |
tcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||||| ||||| || ||||||||||||| |||||||| |||||| ||||| ||| ||||||||||||||| |
|
|
| T |
45523676 |
tcagttggtaggacaatgtataattatatgcaggggtcggggttcgaaccccaaacacctcacctattcaccttataag |
45523754 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #70
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 188 - 273
Target Start/End: Original strand, 1244568 - 1244653
Alignment:
| Q |
188 |
cgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
|||||||||| |||||||| |||| || |||| ||||||||||| ||||||| |||||||||||||||||||||||||||| |
|
|
| T |
1244568 |
cgtgagcatagttcagttggcagggacatacattgctatatgcaggggtgggggttcgaaccccggacaccccacttattcacctt |
1244653 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #71
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 213 - 278
Target Start/End: Original strand, 18255645 - 18255710
Alignment:
| Q |
213 |
caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||| |||||||||||| ||| | ||| |||| |||||||||||||||||||| ||||||| |
|
|
| T |
18255645 |
caatgcatttttatatgcaggggccgagtttcgaacctcggacaccccacttattcacattataag |
18255710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #72
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 225 - 278
Target Start/End: Complemental strand, 34018129 - 34018076
Alignment:
| Q |
225 |
atatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||| | ||||||| |||| |||||||||||||||||||||||||||| |
|
|
| T |
34018129 |
atatgcaggggctggggttcgaacctcggacaccccacttattcaccttataag |
34018076 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #73
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 187 - 274
Target Start/End: Original strand, 2057479 - 2057564
Alignment:
| Q |
187 |
ccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctta |
274 |
Q |
| |
|
||||||||||| ||||||||| |||| || |||| |||||||||||| | | |||| || |||||||||||||||||||||||||| |
|
|
| T |
2057479 |
ccgtgagcatagctcagttggcagggatatacattgttatatgcagggtc--gagttcgaatcccggacaccccacttattcacctta |
2057564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #74
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 221 - 277
Target Start/End: Original strand, 11837021 - 11837077
Alignment:
| Q |
221 |
tattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataa |
277 |
Q |
| |
|
||||||||| |||| |||||||| ||||||||||||| |||||||||||||||||| |
|
|
| T |
11837021 |
tattatatgtaggggtcggggttcgaaccccggacacctcacttattcaccttataa |
11837077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #75
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 213 - 269
Target Start/End: Original strand, 25731958 - 25732014
Alignment:
| Q |
213 |
caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattca |
269 |
Q |
| |
|
|||||||||||||||||||||| ||| |||| |||| ||||||||||||||||||| |
|
|
| T |
25731958 |
caatgcattattatatgcaggggtcggagttcgaacctcggacaccccacttattca |
25732014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #76
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 185 - 273
Target Start/End: Original strand, 38807877 - 38807965
Alignment:
| Q |
185 |
tcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
||||||||| ||| ||||||||| |||| |||||| |||||||||||||| | | ||| |||||| |||||| |||||||||||||| |
|
|
| T |
38807877 |
tcccgtgagtataactcagttggcagggacatgcataattatatgcagggaatgagattcgaaccccagacaccgcacttattcacctt |
38807965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #77
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 182 - 278
Target Start/End: Original strand, 38820568 - 38820663
Alignment:
| Q |
182 |
atgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||| |||||| |||| |||||||| |||| ||||||||||||||||| |||| | |||||| | | ||| ||||||||| ||||||| |||||||| |
|
|
| T |
38820568 |
atgttccgtgaacatagctcagttgttaggacaatgcattattatatgtaggggctggggtt-tgaacccagacaccccatttattcatcttataag |
38820663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #78
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 181 - 277
Target Start/End: Complemental strand, 39726537 - 39726442
Alignment:
| Q |
181 |
aatgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataa |
277 |
Q |
| |
|
||||||||||||| || ||||||||||||| ||||||||||||||||| |||| || ||||| |||| || ||| ||||||||| ||||||||| |
|
|
| T |
39726537 |
aatgtcccgtgagtctagctcagttggtaggacaatgcattattatatgtaggggtcgaggttcgaacctcgaaca-tccacttatttaccttataa |
39726442 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #79
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 186 - 264
Target Start/End: Original strand, 2643697 - 2643775
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaat-gcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
|||||||||||| |||||||||||||| || |||| |||||||||||| ||||||||| |||||||||||| |||||| |
|
|
| T |
2643697 |
cccgtgagcatagctcagttggtagggatattgcat-attatatgcaggagccggggttcgaaccccggacactccactt |
2643775 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #80
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 183 - 278
Target Start/End: Original strand, 14879122 - 14879217
Alignment:
| Q |
183 |
tgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||||||||| || ||||||||| |||| |||||||||||| |||| | | |||| |||||| | |||| |||||||||||||||||| |
|
|
| T |
14879122 |
tgtcccgtgagcatagttccgttggtaggacaatacattattatatgtaggggctgaagttcaaaccccaaatacccaacttattcaccttataag |
14879217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #81
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 185 - 244
Target Start/End: Complemental strand, 18364474 - 18364415
Alignment:
| Q |
185 |
tcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttc |
244 |
Q |
| |
|
||||||||||||| || ||||||||| |||||||||||||||||||||| |||||||| |
|
|
| T |
18364474 |
tcccgtgagcatagctgagttggtagaacaatgcattattatatgcaggggtcggggttc |
18364415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #82
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 186 - 264
Target Start/End: Original strand, 20919610 - 20919688
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||||||| || |||||||||||||| || ||||| ||| ||||| ||| ||||||||| ||||||||||||||||||| |
|
|
| T |
20919610 |
cccgtgagcttagctcagttggtagggacattgcataatt-tatgctggggccggggttcgaaccccggacaccccactt |
20919688 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #83
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 186 - 273
Target Start/End: Complemental strand, 21875069 - 21874982
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
|||||||||||| ||||||||| || |||||| ||||||||||||| | | ||||| | ||||||||||||||||| |||||||| |
|
|
| T |
21875069 |
cccgtgagcataattcagttggtgggaacatgcataattatatgcaggggcagaggttcgatccccggacaccccactttttcacctt |
21874982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #84
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 218 - 269
Target Start/End: Complemental strand, 33116273 - 33116222
Alignment:
| Q |
218 |
cattattatatgcagggaccggggttctaaccccggacaccccacttattca |
269 |
Q |
| |
|
||||||||||| ||||| ||||||||| |||||||||||||| ||||||||| |
|
|
| T |
33116273 |
cattattatattcaggggccggggttcgaaccccggacaccctacttattca |
33116222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #85
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 186 - 273
Target Start/End: Original strand, 34107271 - 34107358
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
|||||||||||| ||||||||| |||| ||| || ||||||||||||| | ||||| ||| || ||||||||||||||||||||| |
|
|
| T |
34107271 |
cccgtgagcatagctcagttggcagggacatgtataattatatgcaggggttgaggttcgaactccagacaccccacttattcacctt |
34107358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #86
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 186 - 273
Target Start/End: Original strand, 34830584 - 34830670
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
|||||||| ||| |||| ||||||| | ||||||| |||||||||||| ||||||||| ||| |||||||||||| |||||| |||| |
|
|
| T |
34830584 |
cccgtgagtatagctcacttggtagagatatgcattgttatatgcaggg-ccggggttcgaactccggacaccccatttattctcctt |
34830670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #87
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 187 - 278
Target Start/End: Complemental strand, 36072667 - 36072576
Alignment:
| Q |
187 |
ccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||||| |||||||| |||| ||||||| ||||||||| ||| |||| ||| ||| | ||||| |||||||||||||||||||| |
|
|
| T |
36072667 |
ccgtgagcatagctcagttgttaggacaatgcaatattatatgtaggagccggagtttgaacttcagacactccacttattcaccttataag |
36072576 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #88
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 215 - 270
Target Start/End: Original strand, 36413786 - 36413841
Alignment:
| Q |
215 |
atgcattattatatgcagggaccggggttctaaccccggacaccccacttattcac |
270 |
Q |
| |
|
||||||| |||||||||||| |||| |||| ||||| ||||||||||||||||||| |
|
|
| T |
36413786 |
atgcattgttatatgcaggggccggagttcgaaccctggacaccccacttattcac |
36413841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #89
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 199 - 270
Target Start/End: Original strand, 37884844 - 37884915
Alignment:
| Q |
199 |
ctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcac |
270 |
Q |
| |
|
||||||||| |||| |||||||||||||||| ||||||||||||| ||| ||| ||||| | ||||||||| |
|
|
| T |
37884844 |
ctcagttggcagggatatgcattattatatgcggggaccggggttcgaactccgaacaccgcgcttattcac |
37884915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #90
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 181 - 251
Target Start/End: Complemental strand, 40044183 - 40044112
Alignment:
| Q |
181 |
aatgtcccgtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaacccc |
251 |
Q |
| |
|
|||||||| |||||||| ||||||||||| || ||||| |||||||||||||||| |||||||| |||||| |
|
|
| T |
40044183 |
aatgtcccttgagcatagctcagttggtaaggacaatgtattattatatgcaggggtcggggttcgaacccc |
40044112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #91
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 187 - 262
Target Start/End: Complemental strand, 41711733 - 41711658
Alignment:
| Q |
187 |
ccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccac |
262 |
Q |
| |
|
||||||||||| ||| ||||||||| ||||||||||||||||| ||| ||| ||| ||||||||||||||||| |
|
|
| T |
41711733 |
ccgtgagcatagctctgttggtaggacaatgcattattatatgtaggagtcggtgtttgaaccccggacaccccac |
41711658 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #92
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 182 - 256
Target Start/End: Complemental strand, 2558360 - 2558286
Alignment:
| Q |
182 |
atgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggaca |
256 |
Q |
| |
|
|||||||||||| ||| |||| |||||||| ||||||||||||||||| |||| | |||||| ||||| ||||| |
|
|
| T |
2558360 |
atgtcccgtgagaatagctcaattggtaggacaatgcattattatatgtaggggtcagggttcgaaccctggaca |
2558286 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #93
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 187 - 273
Target Start/End: Original strand, 18089727 - 18089813
Alignment:
| Q |
187 |
ccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
||||||||||| ||||||||| || | ||||||||| ||||||||| || | |||| |||||| |||||| |||||||||||||| |
|
|
| T |
18089727 |
ccgtgagcatagctcagttggcagagacatgcattatactatgcaggggccagagttcgaaccccagacacctcacttattcacctt |
18089813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #94
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 27495533 - 27495583
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcaggg |
234 |
Q |
| |
|
||||||| |||||| |||||||||||| |||||||||||||||||||||| |
|
|
| T |
27495533 |
gtcccgtaagcataattcagttggtaggacaatgcattattatatgcaggg |
27495583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #95
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 208 - 274
Target Start/End: Original strand, 32891618 - 32891684
Alignment:
| Q |
208 |
tagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctta |
274 |
Q |
| |
|
|||| |||||||||||||||||||||| ||||||| ||||| | |||||||||||||||| |||| |
|
|
| T |
32891618 |
taggacaatgcattattatatgcaggggttggggttcgaaccctgaacaccccacttattcatctta |
32891684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #96
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 188 - 266
Target Start/End: Complemental strand, 35502169 - 35502091
Alignment:
| Q |
188 |
cgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttat |
266 |
Q |
| |
|
|||||||||| | ||||||||||| |||||||||||||||| |||| ||| ||| ||| ||||||||||||||||| |
|
|
| T |
35502169 |
cgtgagcataacacagttggtaggacaatgcattattatatataggggtcggagtttgaactccggacaccccacttat |
35502091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #97
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 223 - 273
Target Start/End: Original strand, 37912463 - 37912513
Alignment:
| Q |
223 |
ttatatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
||||||| |||| |||||||| |||||||||||||||||||||||||||| |
|
|
| T |
37912463 |
ttatatgtaggggtcggggttcaaaccccggacaccccacttattcacctt |
37912513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #98
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 188 - 274
Target Start/End: Original strand, 39118392 - 39118478
Alignment:
| Q |
188 |
cgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctta |
274 |
Q |
| |
|
||||||| || |||||||||||||| || |||| |||||||||||| || | |||| || |||| ||||||||||||||| ||||| |
|
|
| T |
39118392 |
cgtgagcgtaactcagttggtagggacatacattgttatatgcaggggccagagttcgaatcccgaacaccccacttattctcctta |
39118478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #99
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 185 - 270
Target Start/End: Original strand, 40133477 - 40133560
Alignment:
| Q |
185 |
tcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcac |
270 |
Q |
| |
|
||||||||||||| ||||||||| |||| ||||| |||||| || || ||||||||| |||||| |||||||||||||||||| |
|
|
| T |
40133477 |
tcccgtgagcatagctcagttggcagggatatgcactattatgtg--ggagccggggttcaaaccccagacaccccacttattcac |
40133560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #100
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 189 - 274
Target Start/End: Original strand, 6952273 - 6952357
Alignment:
| Q |
189 |
gtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctta |
274 |
Q |
| |
|
|||| |||| |||||||||| || || ||||| ||||||||| ||| | ||||||| |||||| ||||||||| |||||||||||| |
|
|
| T |
6952273 |
gtgaacatagctcagttggtgggaca-tgcataattatatgcgggggctggggttcgaaccccagacaccccatttattcacctta |
6952357 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #101
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 186 - 260
Target Start/End: Complemental strand, 10463268 - 10463193
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggc--aatgcattattatatgcagggaccggggttctaaccccggacacccc |
260 |
Q |
| |
|
||||||||| || |||||||||||||| |||||||| |||||||||||| ||||||||| ||||||| ||||||| |
|
|
| T |
10463268 |
cccgtgagcttagctcagttggtagggacaaatgcatt-ttatatgcaggggccggggttcgaaccccgaacacccc |
10463193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #102
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 189 - 274
Target Start/End: Original strand, 23403307 - 23403391
Alignment:
| Q |
189 |
gtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctta |
274 |
Q |
| |
|
||||||||| |||||||||||||| || || |||||||||||| || |||||| ||||||||| |||||||||||||||||| |
|
|
| T |
23403307 |
gtgagcatagctcagttggtagggacat-cacatttatatgcaggggcccgggttcgaaccccggattccccacttattcacctta |
23403391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #103
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 186 - 264
Target Start/End: Complemental strand, 23984294 - 23984215
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggc--aatgcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||||||| || |||| ||||||||| |||||||| |||||||||||| || |||||| ||||||||||||||||||| |
|
|
| T |
23984294 |
cccgtgagcttagctcaattggtagggacaaatgcatt-ttatatgcaggggccagggttcgaaccccggacaccccactt |
23984215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #104
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 199 - 264
Target Start/End: Original strand, 44558016 - 44558080
Alignment:
| Q |
199 |
ctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||||||||||| || ||||| ||| ||||||||| | ||||||| ||||||||||||||||||| |
|
|
| T |
44558016 |
ctcagttggtaggacattgcataatt-tatgcaggggctggggttcgaaccccggacaccccactt |
44558080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #105
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 202 - 278
Target Start/End: Original strand, 3364738 - 3364814
Alignment:
| Q |
202 |
agttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||| |||| ||||||||||||||||| ||| ||||| ||| ||||||||||||||||| ||| |||| |
|
|
| T |
3364738 |
agttggtaggacaatacattattatatgcaggggccgaggttcgaactttagacaccccacttattcatcttttaag |
3364814 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #106
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 215 - 270
Target Start/End: Original strand, 10602031 - 10602087
Alignment:
| Q |
215 |
atgcattattatatgcagggaccggggttctaaccc-cggacaccccacttattcac |
270 |
Q |
| |
|
||||||| |||||||||||| |||||||| ||||| |||||||||||||||||||| |
|
|
| T |
10602031 |
atgcattgttatatgcaggggacggggttcgaacccacggacaccccacttattcac |
10602087 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #107
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 202 - 264
Target Start/End: Complemental strand, 17119500 - 17119441
Alignment:
| Q |
202 |
agttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
|||||||||| ||||| |||||||||||||| | ||||||| ||||||||||||||||||| |
|
|
| T |
17119500 |
agttggtaggacaatgtattattatatgcag---ctggggttcgaaccccggacaccccactt |
17119441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #108
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 189 - 273
Target Start/End: Original strand, 18065254 - 18065338
Alignment:
| Q |
189 |
gtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
||||||||| |||||||||||| | ||||||| |||||||||||| | ||||| ||||||| ||||| ||||||||||||| |
|
|
| T |
18065254 |
gtgagcatagctcagttggtagaggcatgcattgttatatgcaggggttgaggttcgaaccccgaacaccttacttattcacctt |
18065338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #109
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 189 - 270
Target Start/End: Original strand, 18254591 - 18254673
Alignment:
| Q |
189 |
gtgagcatacctcagttggtagggc--aatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcac |
270 |
Q |
| |
|
|||||| || |||||||||||||| |||||||| |||||||||||| ||||||||| ||| || |||||||||||| ||||| |
|
|
| T |
18254591 |
gtgagcttaactcagttggtagggataaatgcatt-ttatatgcaggggccggggttcgaactccagacaccccacttcttcac |
18254673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #110
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 187 - 279
Target Start/End: Complemental strand, 26206422 - 26206330
Alignment:
| Q |
187 |
ccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataagt |
279 |
Q |
| |
|
||||||||||| ||||||||| | | |||| |||||||||| ||| | || |||| |||| || |||||||||||||||||||||||||| |
|
|
| T |
26206422 |
ccgtgagcatagctcagttggcaagacaatatattattatatacagcggatggtgttcgaacctcgaacaccccacttattcaccttataagt |
26206330 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #111
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 185 - 273
Target Start/End: Original strand, 32944058 - 32944146
Alignment:
| Q |
185 |
tcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
|||||| | |||| ||||||||| | || ||||||||||||||||||| | ||| |||| ||| ||| ||||| |||||||||||||| |
|
|
| T |
32944058 |
tcccgtaaacatagctcagttggcatggacatgcattattatatgcaggaatcggagttcaaactccgaacacctcacttattcacctt |
32944146 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #112
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 184 - 228
Target Start/End: Original strand, 33956251 - 33956295
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatat |
228 |
Q |
| |
|
|||||||||||||| |||| |||||||| |||||||||||||||| |
|
|
| T |
33956251 |
gtcccgtgagcataactcaattggtaggacaatgcattattatat |
33956295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #113
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 186 - 257
Target Start/End: Original strand, 34613979 - 34614050
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaat-gcattattatatgcagggaccggggttctaaccccggacac |
257 |
Q |
| |
|
||||||||| || |||||||||||||| || |||| ||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
34613979 |
cccgtgagcttagctcagttggtagggatattgcat-attatatgcaggggccggggttcgaaccccggacac |
34614050 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #114
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 190 - 270
Target Start/End: Complemental strand, 36386207 - 36386128
Alignment:
| Q |
190 |
tgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcac |
270 |
Q |
| |
|
|||||||| |||||||||||||| ||||||| |||||||||||| | ||||| || | |||||||||||||||||||| |
|
|
| T |
36386207 |
tgagcatagctcagttggtagggatatgcattgttatatgcaggggtc-gggtttgaatctcggacaccccacttattcac |
36386128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #115
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 184 - 228
Target Start/End: Original strand, 38402792 - 38402836
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatat |
228 |
Q |
| |
|
|||||||||||||| ||| ||||||||| |||||||||||||||| |
|
|
| T |
38402792 |
gtcccgtgagcataactcggttggtaggacaatgcattattatat |
38402836 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #116
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 186 - 257
Target Start/End: Original strand, 44948596 - 44948667
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaat-gcattattatatgcagggaccggggttctaaccccggacac |
257 |
Q |
| |
|
||||||||| || |||||||||||||| || |||| ||||||||||||||||||||||| ||||| |||||| |
|
|
| T |
44948596 |
cccgtgagcttagctcagttggtagggatattgcat-attatatgcagggaccggggttcgaaccctggacac |
44948667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #117
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 221 - 264
Target Start/End: Original strand, 1844852 - 1844895
Alignment:
| Q |
221 |
tattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
|||||||||||||| ||||||||| |||| |||||||||||||| |
|
|
| T |
1844852 |
tattatatgcaggggccggggttcgaacctcggacaccccactt |
1844895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #118
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 186 - 264
Target Start/End: Original strand, 3446730 - 3446808
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaat-gcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||||||| || |||||||||||||| || |||| |||||||||||| ||| ||||| ||||||||||||||||||| |
|
|
| T |
3446730 |
cccgtgagcttagctcagttggtagggatattgcat-attatatgcaggagccgaggttcgaaccccggacaccccactt |
3446808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #119
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 215 - 270
Target Start/End: Complemental strand, 4529832 - 4529777
Alignment:
| Q |
215 |
atgcattattatatgcagggaccggggttctaaccccggacaccccacttattcac |
270 |
Q |
| |
|
|||||||||||||||||||| ||| |||| ||| ||| ||||||||||||||||| |
|
|
| T |
4529832 |
atgcattattatatgcaggggtcggagttcgaactccgaacaccccacttattcac |
4529777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #120
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 221 - 264
Target Start/End: Original strand, 5612989 - 5613032
Alignment:
| Q |
221 |
tattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||||||||| || ||||||||| ||||||||||||||||||| |
|
|
| T |
5612989 |
tattatatgcaagggccggggttcgaaccccggacaccccactt |
5613032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #121
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 218 - 273
Target Start/End: Original strand, 12206527 - 12206582
Alignment:
| Q |
218 |
cattattatatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
||||||||||| ||||| |||||||| ||||||| ||||||| |||||||||||| |
|
|
| T |
12206527 |
cattattatattcaggggtcggggttcgaaccccgaacaccccgcttattcacctt |
12206582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #122
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 221 - 264
Target Start/End: Complemental strand, 17777198 - 17777155
Alignment:
| Q |
221 |
tattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
|||||||||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
17777198 |
tattatatgcaggggtcggggttcgaaccccggacaccccactt |
17777155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #123
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 194 - 277
Target Start/End: Original strand, 20208866 - 20208948
Alignment:
| Q |
194 |
catacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataa |
277 |
Q |
| |
|
|||| ||||||||||| | |||||||||||||||| ||| | | ||||| |||||| ||| ||||||||||||||||||||| |
|
|
| T |
20208866 |
catagctcagttggtaagacaatgcattattatatacagaggttgaggttcgaaccccagac-ccccacttattcaccttataa |
20208948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #124
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 226 - 273
Target Start/End: Original strand, 24202187 - 24202234
Alignment:
| Q |
226 |
tatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
||||||||| ||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
24202187 |
tatgcaggggccggggttcgaaccccggacaccccactatttcacctt |
24202234 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #125
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 221 - 264
Target Start/End: Original strand, 36101694 - 36101737
Alignment:
| Q |
221 |
tattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
|||||||||||||| | ||||||| ||||||||||||||||||| |
|
|
| T |
36101694 |
tattatatgcaggggctggggttcgaaccccggacaccccactt |
36101737 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #126
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 186 - 264
Target Start/End: Complemental strand, 40535519 - 40535441
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggta-gggcaatgcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||||||| || ||||||||||| || | |||| |||||||||||||| ||||||||| |||||||||||| |||||| |
|
|
| T |
40535519 |
cccgtgagcttagctcagttggtacggatattgca-tattatatgcaggggccggggttcgaaccccggacactccactt |
40535441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #127
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 190 - 273
Target Start/End: Complemental strand, 41305160 - 41305077
Alignment:
| Q |
190 |
tgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
|||||||| ||||||||| || | ||| |||| ||||||||||| | | ||||| ||| ||||| |||||||||||||||||| |
|
|
| T |
41305160 |
tgagcatagctcagttggcagaggcatgtattagtatatgcaggggctgaggttcaaactccggataccccacttattcacctt |
41305077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #128
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 226 - 264
Target Start/End: Original strand, 1964393 - 1964431
Alignment:
| Q |
226 |
tatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
1964393 |
tatgcaggggccggggttcaaaccccggacaccccactt |
1964431 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #129
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 228 - 274
Target Start/End: Complemental strand, 5901887 - 5901841
Alignment:
| Q |
228 |
tgcagggaccggggttctaaccccggacaccccacttattcacctta |
274 |
Q |
| |
|
||||||| ||||||| | |||||||||||||||||||||||| |||| |
|
|
| T |
5901887 |
tgcaggggccggggtacaaaccccggacaccccacttattcatctta |
5901841 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #130
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 215 - 273
Target Start/End: Complemental strand, 25406719 - 25406661
Alignment:
| Q |
215 |
atgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
|||||||||||||| | || |||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
25406719 |
atgcattattatatatatgggtcggggttcgaactccggacaccccacttattcacctt |
25406661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #131
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 214 - 264
Target Start/End: Original strand, 32220996 - 32221045
Alignment:
| Q |
214 |
aatgcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
|||||||| |||||||||||| ||||||||| |||| |||||||||||||| |
|
|
| T |
32220996 |
aatgcatt-ttatatgcaggggccggggttcgaacctcggacaccccactt |
32221045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #132
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 184 - 258
Target Start/End: Complemental strand, 35049249 - 35049176
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacacc |
258 |
Q |
| |
|
||||| |||||||| |||||||||||| |||||||||||||||| || || |||||||| |||| |||||||| |
|
|
| T |
35049249 |
gtcccatgagcataactcagttggtagaacaatgcattattatatacaagg-tcggggttcgaacctcggacacc |
35049176 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #133
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 184 - 274
Target Start/End: Complemental strand, 37065534 - 37065444
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctta |
274 |
Q |
| |
|
|||||||||||||| ||| ||||||| || ||||||| |||||||||| | |||||||| ||| ||| |||| |||| |||||||||| |
|
|
| T |
37065534 |
gtcccgtgagcatagctctgttggtatggacatgcattgttatatgcagtggtcggggttcgaactccgatcacctcactaattcacctta |
37065444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #134
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 184 - 274
Target Start/End: Original strand, 37245373 - 37245463
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctta |
274 |
Q |
| |
|
||||| ||| |||| |||| |||||||| || |||||||||||||| |||| | || |||| ||||| | |||| |||| ||||||||||| |
|
|
| T |
37245373 |
gtcccatgatcatagctcaattggtaggacagtgcattattatatgtaggggctggagttcgaacccggtacactccacctattcacctta |
37245463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #135
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 187 - 264
Target Start/End: Original strand, 41509517 - 41509594
Alignment:
| Q |
187 |
ccgtgagcatacctcagttggtagggcaat-gcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
|||||||| || |||||||||||||| || |||| |||||||||||| ||||||||| |||||||||||| |||||| |
|
|
| T |
41509517 |
ccgtgagcttagctcagttggtagggatattgcat-attatatgcaggagccggggttcgaaccccggacactccactt |
41509594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #136
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 187 - 260
Target Start/End: Complemental strand, 917388 - 917315
Alignment:
| Q |
187 |
ccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacacccc |
260 |
Q |
| |
|
|||||||| || |||||||||||| | |||||||||||||||||||| |||| ||| ||||| | ||||||| |
|
|
| T |
917388 |
ccgtgagcttaactcagttggtagagacatgcattattatatgcaggggtcgggattcgaaccctgaacacccc |
917315 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #137
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 214 - 263
Target Start/End: Original strand, 5947895 - 5947943
Alignment:
| Q |
214 |
aatgcattattatatgcagggaccggggttctaaccccggacaccccact |
263 |
Q |
| |
|
|||||||| |||||||||||| |||||||| |||||||||||||||||| |
|
|
| T |
5947895 |
aatgcatt-ttatatgcaggggtcggggttcgaaccccggacaccccact |
5947943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #138
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 189 - 257
Target Start/End: Complemental strand, 6636034 - 6635966
Alignment:
| Q |
189 |
gtgagcatacctcagttggtagggcaat-gcattattatatgcagggaccggggttctaaccccggacac |
257 |
Q |
| |
|
|||||| || |||||||||||||| || |||| ||||||||||||||| ||||||| |||||||||||| |
|
|
| T |
6636034 |
gtgagcttagctcagttggtagggatattgcat-attatatgcagggacgggggttcgaaccccggacac |
6635966 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #139
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 186 - 258
Target Start/End: Original strand, 7052770 - 7052843
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacacc |
258 |
Q |
| |
|
||||||||| || ||||||||||| || |||||||| || ||||||| || |||||| || ||||||||||||| |
|
|
| T |
7052770 |
cccgtgagcttagctcagttggtaaggacaatgcataataatatgcaaggtccggggctcaaaccccggacacc |
7052843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #140
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 183 - 264
Target Start/End: Original strand, 16261326 - 16261407
Alignment:
| Q |
183 |
tgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||| ||||||||| |||| ||||||| |||||||| |||||||||||| | | |||| |||||| |||||||||||| |
|
|
| T |
16261326 |
tgtcctgtgagcatagctcaattggtagtataatgcattgttatatgcaggggtcagagttcgaaccccagacaccccactt |
16261407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #141
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 188 - 264
Target Start/End: Complemental strand, 28195202 - 28195126
Alignment:
| Q |
188 |
cgtgagcatacctcagttggtagggcaat-gcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||||| || |||||||||||||| || |||| |||||||||| || | ||||||||||||||||| ||||||||| |
|
|
| T |
28195202 |
cgtgagcttagctcagttggtagggatattgcat-attatatgcaagggcaggggttctaaccccggataccccactt |
28195126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #142
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 200 - 264
Target Start/End: Complemental strand, 32190058 - 32189994
Alignment:
| Q |
200 |
tcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||||||||||| || ||||| ||| ||||||||| ||||||||| ||||||||||||| ||||| |
|
|
| T |
32190058 |
tcagttggtagggacattgcataatt-tatgcaggggccggggttcgaaccccggacacctcactt |
32189994 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #143
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 224 - 269
Target Start/End: Complemental strand, 33482702 - 33482657
Alignment:
| Q |
224 |
tatatgcagggaccggggttctaaccccggacaccccacttattca |
269 |
Q |
| |
|
||||||||||||||| ||||| |||| | ||||||||||||||||| |
|
|
| T |
33482702 |
tatatgcagggaccgtggttcgaacctcagacaccccacttattca |
33482657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #144
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 186 - 266
Target Start/End: Complemental strand, 38557293 - 38557213
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaatg-cattattatatgcagggaccggggttctaaccccggacaccccacttat |
266 |
Q |
| |
|
||||||||| || |||||||||||||| ||| |||| |||||||||||| |||||||| |||||||||||| ||||||| |
|
|
| T |
38557293 |
cccgtgagcttaactcagttggtagggatatggcatt-ttatatgcaggggtcggggttcgaaccccggacacttcacttat |
38557213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #145
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 186 - 278
Target Start/End: Complemental strand, 41196041 - 41195948
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||||| |||||||| |||| |||||||| |||||||||| | |||| |||| || |||| ||||| || |||||||||| ||||| |
|
|
| T |
41196041 |
cccgtgagcatagctcagttgacagggataatgcattgttatatgcagaggccggagttcgaatcccgaacacctcatttattcacctaataag |
41195948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #146
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 188 - 264
Target Start/End: Complemental strand, 44857302 - 44857226
Alignment:
| Q |
188 |
cgtgagcatacctcagttggtagggcaat-gcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||||| || |||||||||||||| || |||| ||||||||||||| ||| ||||| |||||||||||| |||||| |
|
|
| T |
44857302 |
cgtgagcttagctcagttggtagggatattgcat-attatatgcaggggccgaggttcgaaccccggacactccactt |
44857226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #147
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 181 - 209
Target Start/End: Complemental strand, 1605910 - 1605882
Alignment:
| Q |
181 |
aatgtcccgtgagcatacctcagttggta |
209 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
1605910 |
aatgtcccgtgagcatacctcagttggta |
1605882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #148
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 186 - 270
Target Start/End: Original strand, 6282232 - 6282316
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcac |
270 |
Q |
| |
|
|||||||| ||| |||||||| ||||| | ||||||||||||||| || ||||||| |||||| ||||| ||||||||||| |
|
|
| T |
6282232 |
cccgtgagtatagctcagttgttagggacacgcattattatatgcaagggacggggtttgaaccccaaacacctcacttattcac |
6282316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #149
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 186 - 257
Target Start/End: Complemental strand, 8250371 - 8250300
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaat-gcattattatatgcagggaccggggttctaaccccggacac |
257 |
Q |
| |
|
||||||||| || |||||||||||||| || |||| ||||||||||||| ||||||||| |||||| ||||| |
|
|
| T |
8250371 |
cccgtgagcttagctcagttggtagggatattgcat-attatatgcaggggccggggttcgaaccccagacac |
8250300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #150
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 218 - 274
Target Start/End: Complemental strand, 29713155 - 29713099
Alignment:
| Q |
218 |
cattattatatgcagggaccggggttctaaccccggacaccccacttattcacctta |
274 |
Q |
| |
|
|||| ||||||||||||| ||||||| |||||| ||||||| ||||||| |||||| |
|
|
| T |
29713155 |
cattgttatatgcagggattggggttcgaaccccagacaccctacttatttacctta |
29713099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #151
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 241 - 273
Target Start/End: Complemental strand, 33613648 - 33613616
Alignment:
| Q |
241 |
gttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
|||| |||||||||||||||||||||||||||| |
|
|
| T |
33613648 |
gttcgaaccccggacaccccacttattcacctt |
33613616 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #152
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 214 - 278
Target Start/End: Original strand, 41535214 - 41535278
Alignment:
| Q |
214 |
aatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||||| || ||| || | ||||| ||||||||| ||||||||||||||| ||||||| |
|
|
| T |
41535214 |
aatgcattattaaatacagagattgaggttcgaaccccggataccccacttattcactttataag |
41535278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8 (Bit Score: 79; Significance: 6e-37; HSPs: 168)
Name: chr8
Description:
Target: chr8; HSP #1
Raw Score: 79; E-Value: 6e-37
Query Start/End: Original strand, 184 - 278
Target Start/End: Complemental strand, 15042465 - 15042371
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||||||| ||||||||||||| |||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
15042465 |
gtcccgtgagcatagctcagttggtaggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttattcaccttataag |
15042371 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #2
Raw Score: 72; E-Value: 9e-33
Query Start/End: Original strand, 183 - 278
Target Start/End: Original strand, 9524951 - 9525046
Alignment:
| Q |
183 |
tgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||||||||| ||||||||||||| |||||||||||||||||||||| ||||||||| |||||| ||||||| |||||||||||||||||| |
|
|
| T |
9524951 |
tgtcccgtgagcatagctcagttggtaggacaatgcattattatatgcaggggccggggttcgaaccccagacaccctacttattcaccttataag |
9525046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #3
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 184 - 278
Target Start/End: Complemental strand, 24608583 - 24608489
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||||||| ||||||||||||| |||||||||||||||||||||| ||||||||| |||||| ||||||| |||||||||||||||||| |
|
|
| T |
24608583 |
gtcccgtgagcatagctcagttggtaggacaatgcattattatatgcaggggccggggttcgaaccccagacaccctacttattcaccttataag |
24608489 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #4
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 183 - 278
Target Start/End: Complemental strand, 4798642 - 4798547
Alignment:
| Q |
183 |
tgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||||| ||| ||||||||||||| ||||||||||||||||||||| ||||||||| |||||||||||||||||||||||||||| |||| |
|
|
| T |
4798642 |
tgtcccgtgagtatagctcagttggtaggataatgcattattatatgcaggggccggggttcgaaccccggacaccccacttattcaccttgtaag |
4798547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #5
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 184 - 278
Target Start/End: Complemental strand, 39484470 - 39484376
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||||||| ||||||||||||| |||||||||||||||||||||| ||||||||| || |||||||||||||||||||| |||||||| |
|
|
| T |
39484470 |
gtcccgtgagcatagctcagttggtaggacaatgcattattatatgcaggggccggggttcgaatgccggacaccccacttattcatcttataag |
39484376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #6
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 186 - 281
Target Start/End: Original strand, 2696529 - 2696625
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataagtga |
281 |
Q |
| |
|
|||||||||||| ||||||||| |||| |||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||| ||| |||||| |
|
|
| T |
2696529 |
cccgtgagcataactcagttggcagggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttattcactttaaaagtga |
2696625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #7
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 186 - 281
Target Start/End: Original strand, 2800015 - 2800111
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataagtga |
281 |
Q |
| |
|
|||||||||||| ||||||||| |||| |||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||| ||| |||||| |
|
|
| T |
2800015 |
cccgtgagcatagctcagttggcagggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttattcactttaaaagtga |
2800111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #8
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 183 - 278
Target Start/End: Complemental strand, 5184988 - 5184893
Alignment:
| Q |
183 |
tgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||| ||||||||| ||||||||||||| ||||| |||||||||||||||| | ||||||| ||||| ||||||||||||||||||||||||||| |
|
|
| T |
5184988 |
tgtcctgtgagcatagctcagttggtaggacaatggattattatatgcaggggctggggttcgaaccctggacaccccacttattcaccttataag |
5184893 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #9
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 183 - 266
Target Start/End: Original strand, 17980276 - 17980359
Alignment:
| Q |
183 |
tgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttat |
266 |
Q |
| |
|
||||||||||||||| ||||||||||||| ||| |||||||||||||||||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
17980276 |
tgtcccgtgagcatagctcagttggtaggacaaagcattattatatgcaggggccggggttcgaaccccggacaccccacttat |
17980359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #10
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 183 - 278
Target Start/End: Complemental strand, 17987550 - 17987455
Alignment:
| Q |
183 |
tgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||| |||| ||||||||||||| ||||||||||||||||||||| |||| |||| |||||||||||||||| |||||||||||||||| |
|
|
| T |
17987550 |
tgtcccgtgaacatagctcagttggtaggataatgcattattatatgcaggggccggagttcgaaccccggacaccccaattattcaccttataag |
17987455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #11
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 184 - 278
Target Start/End: Original strand, 10970261 - 10970355
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||| ||||||||| ||||||||||||| ||||||||||||||||||||| | ||||||| ||||||| ||||||||||||||||||||||||| |
|
|
| T |
10970261 |
gtcctgtgagcatagctcagttggtaggataatgcattattatatgcaggggctggggttcaaaccccgaacaccccacttattcaccttataag |
10970355 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #12
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 184 - 278
Target Start/End: Complemental strand, 43468805 - 43468711
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||||||| ||||||||||||| ||||||||| ||||||| |||| |||||||| ||| ||||||||||||||||||||||||||||| |
|
|
| T |
43468805 |
gtcccgtgagcatagctcagttggtaggacaatgcattgttatatgtaggggtcggggttcgaactccggacaccccacttattcaccttataag |
43468711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #13
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 189 - 278
Target Start/End: Complemental strand, 7540583 - 7540494
Alignment:
| Q |
189 |
gtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||| |||| |||||||| |||||||||||||||||||||| |||||||||||||| ||||| ||||||||||||||||||||| |
|
|
| T |
7540583 |
gtgagcataactcacttggtaggacaatgcattattatatgcaggggtcggggttctaaccctggacaacccacttattcaccttataag |
7540494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #14
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 181 - 276
Target Start/End: Complemental strand, 23857427 - 23857331
Alignment:
| Q |
181 |
aatgtcccgtgagcatacctcagttggtagggcaatgcattattatatgca-gggaccggggttctaaccccggacaccccacttattcaccttata |
276 |
Q |
| |
|
||||||||||||||||| ||||||||||||| ||||||||||||||||||| ||| ||||||||| |||| ||||||||| ||||||||| |||||| |
|
|
| T |
23857427 |
aatgtcccgtgagcatagctcagttggtaggacaatgcattattatatgcagggggccggggttcgaacctcggacacccgacttattcatcttata |
23857331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #15
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 183 - 266
Target Start/End: Original strand, 43847696 - 43847779
Alignment:
| Q |
183 |
tgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttat |
266 |
Q |
| |
|
|||| |||||||||| ||||||||||||| |||||||||||||||||||||| ||||||||| ||||||| ||||||||||||| |
|
|
| T |
43847696 |
tgtctcgtgagcatagctcagttggtaggacaatgcattattatatgcaggggccggggttcgaaccccgaacaccccacttat |
43847779 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #16
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 184 - 278
Target Start/End: Original strand, 8034525 - 8034619
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||||||| ||| ||| |||| ||||||||||||||||||||| ||||||||| ||||||| ||||||||||||||||||||||||| |
|
|
| T |
8034525 |
gtcccgtgagcataactccgttaataggacaatgcattattatatgcaggagccggggttcgaaccccgaacaccccacttattcaccttataag |
8034619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #17
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 183 - 278
Target Start/End: Complemental strand, 40249981 - 40249884
Alignment:
| Q |
183 |
tgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacac--cccacttattcaccttataag |
278 |
Q |
| |
|
||||||||||||||| ||||||||||||| |||||||||||||||||||| || ||| |||| ||| |||||||| ||||||||||||||||||||| |
|
|
| T |
40249981 |
tgtcccgtgagcataactcagttggtaggacaatgcattattatatgcagtgatcggagttcgaactccggacacctcccacttattcaccttataag |
40249884 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #18
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 180 - 281
Target Start/End: Original strand, 1588756 - 1588859
Alignment:
| Q |
180 |
aaatgtccc-gtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataa |
277 |
Q |
| |
|
||||||||| ||||||||| || |||||| |||| |||||||||||||||||||||| ||||||||| |||| |||||||||||||||||||| ||| || |
|
|
| T |
1588756 |
aaatgtccctgtgagcatagcttagttggcagggacaatgcattattatatgcaggggccggggttcgaacctcggacaccccacttattcactttaaaa |
1588855 |
T |
 |
| Q |
278 |
gtga |
281 |
Q |
| |
|
|||| |
|
|
| T |
1588856 |
gtga |
1588859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #19
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 199 - 278
Target Start/End: Complemental strand, 10199827 - 10199748
Alignment:
| Q |
199 |
ctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||| ||||| |||||||||||||||||||||| ||||||||| |||||| ||||||||||||||||||||||||| |
|
|
| T |
10199827 |
ctcagttagtaggacaatgcattattatatgcaggggccggggttcgaaccccaaacaccccacttattcaccttataag |
10199748 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #20
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 182 - 277
Target Start/End: Complemental strand, 25689490 - 25689395
Alignment:
| Q |
182 |
atgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataa |
277 |
Q |
| |
|
||||| |||||||||| ||||||||||||| || |||||||||||||| |||| ||| ||||| |||||||||||||| ||||| ||||||||||| |
|
|
| T |
25689490 |
atgtctcgtgagcatagctcagttggtaggacactgcattattatatgtaggggccgaggttcgaaccccggacaccctacttaatcaccttataa |
25689395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #21
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 188 - 278
Target Start/End: Complemental strand, 26703986 - 26703896
Alignment:
| Q |
188 |
cgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||| ||||||||||||| ||||||||||||||||||| || |||||||| || |||| ||||| ||||||||||||||||||| |
|
|
| T |
26703986 |
cgtgagcataactcagttggtaggacaatgcattattatatgcaagggtcggggttcgaatcccgaacacctcacttattcaccttataag |
26703896 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #22
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 189 - 273
Target Start/End: Original strand, 26657856 - 26657941
Alignment:
| Q |
189 |
gtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggaca-ccccacttattcacctt |
273 |
Q |
| |
|
||||||||| |||||||||||||| ||||||| |||||||||||||||||||||| |||||| |||| ||||||||||||||||| |
|
|
| T |
26657856 |
gtgagcatagctcagttggtagggacatgcattgttatatgcagggaccggggttcgaaccccagacacccccacttattcacctt |
26657941 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #23
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 189 - 278
Target Start/End: Complemental strand, 30942694 - 30942605
Alignment:
| Q |
189 |
gtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||| |||| |||| ||| |||| |||||||||||||||||||||| ||||||||| ||||||| |||||||||||||| |||||||||| |
|
|
| T |
30942694 |
gtgaacataactcaattgataggacaatgcattattatatgcaggggccggggttcgaaccccgaacaccccacttatttaccttataag |
30942605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #24
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 186 - 281
Target Start/End: Complemental strand, 38790672 - 38790575
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccgggg-ttctaaccccggacaccccacttattcaccttataagtga |
281 |
Q |
| |
|
|||||||||||| ||||||||| |||| |||||||||||||||||||||| |||||| ||| |||||| |||||||||||||||||| ||| |||||| |
|
|
| T |
38790672 |
cccgtgagcataactcagttggcagggacaatgcattattatatgcaggggccgggggttcgaaccccagacaccccacttattcactttaaaagtga |
38790575 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #25
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 182 - 278
Target Start/End: Complemental strand, 9737462 - 9737366
Alignment:
| Q |
182 |
atgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||||||||| ||||||||||||| |||| ||||||||||| |||| ||| ||||| ||| |||||||||||||||||| || ||||||| |
|
|
| T |
9737462 |
atgtcccgtgagcatagctcagttggtaggacaatacattattatatataggggccgaggttcgaactccggacaccccacttatttactttataag |
9737366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #26
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 189 - 273
Target Start/End: Original strand, 17467278 - 17467361
Alignment:
| Q |
189 |
gtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
||||||||| |||||||||||||| || ||||||||||||||||| || |||||| |||||||||||||||||||||||||||| |
|
|
| T |
17467278 |
gtgagcataactcagttggtagggatatacattattatatgcaggggcc-gggttcgaaccccggacaccccacttattcacctt |
17467361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #27
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 187 - 281
Target Start/End: Original strand, 7314730 - 7314825
Alignment:
| Q |
187 |
ccgtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataagtga |
281 |
Q |
| |
|
||||||||||| |||| |||| |||| |||| ||||||||||||||||| ||| ||||| ||||||||||||||||||||||||| ||| |||||| |
|
|
| T |
7314730 |
ccgtgagcataactcaattggcagggacaatacattattatatgcaggggccgaggttcgaaccccggacaccccacttattcactttaaaagtga |
7314825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #28
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 183 - 274
Target Start/End: Original strand, 7649523 - 7649613
Alignment:
| Q |
183 |
tgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctta |
274 |
Q |
| |
|
||||||||||||||| |||| |||||||| ||||||||||||||||| |||| | ||||||| |||| || ||||||||||||||||||||| |
|
|
| T |
7649523 |
tgtcccgtgagcatagctcacttggtaggacaatgcattattatatgtaggg-ctggggttcgaacctcgaacaccccacttattcacctta |
7649613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #29
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 183 - 274
Target Start/End: Complemental strand, 13762613 - 13762522
Alignment:
| Q |
183 |
tgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctta |
274 |
Q |
| |
|
||||| ||||||||| |||||||||||| |||||||||||||||||||||| | | |||| |||| |||||||||||||||||||||||| |
|
|
| T |
13762613 |
tgtcctgtgagcatagttcagttggtaggacaatgcattattatatgcaggggtcagtgttcgaaccacggacaccccacttattcacctta |
13762522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #30
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 183 - 278
Target Start/End: Complemental strand, 14010873 - 14010778
Alignment:
| Q |
183 |
tgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||||||||| ||||||||||| | || |||||||||||||| | |||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
14010873 |
tgtcccgtgagcatagctcagttggtaagacagtgcattattatatgttatggtcggggttcgaaccccggacaccccacttattcaccttataag |
14010778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #31
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 183 - 278
Target Start/End: Complemental strand, 34073340 - 34073245
Alignment:
| Q |
183 |
tgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||||| || |||||||||||| |||||||||||||||| |||| | ||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
34073340 |
tgtcccgtgagcgtagttcagttggtaggataatgcattattatatgtaggggtcaaggttcgaaccccggacaccccacttattcaccttataag |
34073245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #32
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 183 - 278
Target Start/End: Original strand, 42688050 - 42688145
Alignment:
| Q |
183 |
tgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||| |||||||||| |||||||||||| ||||||||||||||||| |||| |||| ||| ||||||| |||||||||||||| |||||||||| |
|
|
| T |
42688050 |
tgtctcgtgagcatagttcagttggtaggacaatgcattattatatgtaggggtcgggattcgaaccccgaacaccccacttatttaccttataag |
42688145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #33
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 187 - 278
Target Start/End: Complemental strand, 42761962 - 42761871
Alignment:
| Q |
187 |
ccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||||| ||||||||||| | |||||||||||||||||||||| |||||||| ||| | |||||| |||||||||||| ||||||| |
|
|
| T |
42761962 |
ccgtgagcataactcagttggtatgacaatgcattattatatgcagggggcggggttcgaactctggacactccacttattcactttataag |
42761871 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #34
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 186 - 278
Target Start/End: Original strand, 14012608 - 14012701
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||||| |||||||| |||| ||||||||| |||||||||||| ||||||||| || ||||||||||||||||||||| ||||||| |
|
|
| T |
14012608 |
cccgtgagcatagttcagttggcagggacaatgcattgttatatgcaggggccggggttcgaagtccggacaccccacttattcacattataag |
14012701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #35
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 184 - 273
Target Start/End: Original strand, 25119203 - 25119292
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
|||||||||||||| ||| |||||||| |||||||||||||||||||||| ||||||| ||||||||||| |||||| ||||||||| |
|
|
| T |
25119203 |
gtcccgtgagcatagttcaattggtaggacaatgcattattatatgcaggggttggggttcgaaccccggacatcccactcattcacctt |
25119292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #36
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 189 - 278
Target Start/End: Original strand, 37219505 - 37219594
Alignment:
| Q |
189 |
gtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||| ||||||||||||| |||| ||||||||||||||| ||||||| |||||||||||||||| |||||||||||||||| |
|
|
| T |
37219505 |
gtgagcataactcagttggtaggacaatatattattatatgcaggtgttggggttcaaaccccggacaccccatttattcaccttataag |
37219594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #37
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 184 - 272
Target Start/End: Original strand, 2376513 - 2376601
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacct |
272 |
Q |
| |
|
|||||||||||||| ||| |||||||| |||||||||||||||||||||| | |||||| |||| ||||||| |||||||||||||| |
|
|
| T |
2376513 |
gtcccgtgagcatagttcaattggtaggacaatgcattattatatgcaggggtccgggttcgaacctcggacactccacttattcacct |
2376601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #38
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 186 - 281
Target Start/End: Original strand, 10292348 - 10292444
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataagtga |
281 |
Q |
| |
|
|||||||||||| ||||||||| |||| |||||||||||||||||||||| | | | ||| |||| |||||||||||||||||||| ||| |||||| |
|
|
| T |
10292348 |
cccgtgagcatagctcagttggcagggacaatgcattattatatgcaggggctgagattcgaacctcggacaccccacttattcactttaaaagtga |
10292444 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #39
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 190 - 278
Target Start/End: Complemental strand, 43875071 - 43874983
Alignment:
| Q |
190 |
tgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||| |||||||| |||| ||||||||||||||||| |||| | | ||||| ||| || |||||||||||||||||||||||||| |
|
|
| T |
43875071 |
tgagcataactcagttgataggacaatgcattattatatgtaggggctgaggttcgaacaccagacaccccacttattcaccttataag |
43874983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #40
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 183 - 278
Target Start/End: Complemental strand, 3379747 - 3379654
Alignment:
| Q |
183 |
tgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||||||||| |||||||| |||| |||||||| |||||||||||| | |||||| |||||| |||||||||||||||||||||||||| |
|
|
| T |
3379747 |
tgtcccgtgagcataactcagttgataggataatgcattgttatatgcaggg-gctgggttcgaacccc-gacaccccacttattcaccttataag |
3379654 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #41
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 183 - 278
Target Start/End: Original strand, 6064371 - 6064466
Alignment:
| Q |
183 |
tgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||||| || |||| ||||| || |||||||||||||||||||||| |||||||| |||| ||||||| |||||||||| |||||||| |
|
|
| T |
6064371 |
tgtcccgtgagcttagctcaattggttggacaatgcattattatatgcaggggtcggggttcgaacctcggacacttcacttattcagcttataag |
6064466 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #42
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 191 - 278
Target Start/End: Complemental strand, 8740749 - 8740662
Alignment:
| Q |
191 |
gagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||| ||||||||||||| ||||||| |||||||||||||| | | ||||| ||| |||||||||| ||||||||| |||||||| |
|
|
| T |
8740749 |
gagcataactcagttggtaggacaatgcagtattatatgcaggggctgaggttcgaactccggacaccctacttattcatcttataag |
8740662 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #43
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 180 - 278
Target Start/End: Original strand, 28378803 - 28378902
Alignment:
| Q |
180 |
aaatgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggaca-ccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||||||| |||| |||| |||||||| ||| |||||||||||||||| | | ||||| ||||||||||| |||||||||||||||||||||| |
|
|
| T |
28378803 |
aaatgtcccgtgaacatagctcaattggtaggacaagatattattatatgcaggggctgaggttcgaaccccggacacccccacttattcaccttataag |
28378902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #44
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 187 - 278
Target Start/End: Complemental strand, 44070465 - 44070374
Alignment:
| Q |
187 |
ccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||| || ||||||| ||||| |||| |||||||||||| |||| ||| ||||| |||| ||||||||| |||||||||||||||||| |
|
|
| T |
44070465 |
ccgtgagcgtagctcagttagtaggacaatacattattatatgtaggggccgcggttcgaacctcggacaccctacttattcaccttataag |
44070374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #45
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 184 - 278
Target Start/End: Complemental strand, 1033060 - 1032967
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||| || |||||||||| || |||||||||||||||||||||| ||| |||| || |||| ||||||||||||||||||||||||| |
|
|
| T |
1033060 |
gtcccgtgagtctagctcagttggtgggacaatgcattattatatgcaggggtcggagttcgaa-cccgaacaccccacttattcaccttataag |
1032967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #46
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 185 - 274
Target Start/End: Original strand, 7345424 - 7345513
Alignment:
| Q |
185 |
tcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctta |
274 |
Q |
| |
|
||||||||||||| ||||||||| |||| |||||||||||||||||||| |||| ||| ||| || ||||||||||||||||||||| |
|
|
| T |
7345424 |
tcccgtgagcataactcagttggcagggacatgcattattatatgcaggggtcgggcttccaactccaaacaccccacttattcacctta |
7345513 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #47
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 213 - 278
Target Start/End: Original strand, 14683901 - 14683965
Alignment:
| Q |
213 |
caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||||||||||||||| | ||||||| ||||||||||| ||||||||||||||||||||| |
|
|
| T |
14683901 |
caatgcattattatatgcagggtc-ggggttcgaaccccggacatcccacttattcaccttataag |
14683965 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #48
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 184 - 277
Target Start/End: Complemental strand, 35556486 - 35556393
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataa |
277 |
Q |
| |
|
|||||||||||||| || |||||||||| |||||||||| |||||| |||| ||||||| |||||||||||||| ||||| |||||||||| |
|
|
| T |
35556486 |
gtcccgtgagcatagcttagttggtaggacaatgcattagtatatgtaggggttggggttcgaaccccggacacccgacttagccaccttataa |
35556393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #49
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 218 - 270
Target Start/End: Original strand, 33524425 - 33524477
Alignment:
| Q |
218 |
cattattatatgcagggaccggggttctaaccccggacaccccacttattcac |
270 |
Q |
| |
|
||||||||||||||| ||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
33524425 |
cattattatatgcagagaccggggttcgaaccccggacaccccacttattcac |
33524477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #50
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 184 - 275
Target Start/End: Complemental strand, 27558970 - 27558880
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttat |
275 |
Q |
| |
|
||||||||||| || |||| |||||||| ||||||||||||||||||||| |||| ||| || ||| ||||||||||||||||||||||| |
|
|
| T |
27558970 |
gtcccgtgagcgtagctcatttggtaggataatgcattattatatgcaggggtcgggattcgaa-cccagacaccccacttattcaccttat |
27558880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #51
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 183 - 278
Target Start/End: Original strand, 27822064 - 27822159
Alignment:
| Q |
183 |
tgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||| |||| |||| ||||||||||||| ||||||||||||||||||||| | || || |||||| ||||||||||||||||||||||||| |
|
|
| T |
27822064 |
tgtcctgtgaacataactcagttggtaggataatgcattattatatgcaggggtccggatttgaaccccaaacaccccacttattcaccttataag |
27822159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #52
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 183 - 278
Target Start/End: Original strand, 31373314 - 31373409
Alignment:
| Q |
183 |
tgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||||||||| ||||||||||||| || | |||||||||||| |||| | | ||||| || |||||||| |||| ||||||||||||||| |
|
|
| T |
31373314 |
tgtcccgtgagcatagctcagttggtaggacattacattattatatgtaggggcagaggttcgaatcccggacatcccatatattcaccttataag |
31373409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #53
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 199 - 281
Target Start/End: Complemental strand, 35301249 - 35301166
Alignment:
| Q |
199 |
ctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataagtga |
281 |
Q |
| |
|
||||||||| |||| |||||||||||||||||||||| |||||||| ||| |||||||||| |||||||||| ||| |||||| |
|
|
| T |
35301249 |
ctcagttggcagggacaatgcattattatatgcaggggtcggggttcgaactccggacaccctacttattcactttaaaagtga |
35301166 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #54
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 219 - 278
Target Start/End: Complemental strand, 36359783 - 36359724
Alignment:
| Q |
219 |
attattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||||||||| |||| |||| || |||||||||||||||||||||||||||||| |
|
|
| T |
36359783 |
attattatatgcaggggccggagttcgaatcccggacaccccacttattcaccttataag |
36359724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #55
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 187 - 278
Target Start/End: Complemental strand, 44136374 - 44136283
Alignment:
| Q |
187 |
ccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||||| ||||||||||||| |||| |||||||||||||||| | | ||||| |||||| |||||| || |||||||| ||||||| |
|
|
| T |
44136374 |
ccgtgagcataactcagttggtaggacaatatattattatatgcaggggctgaggttcgaaccccagacacctcaattattcactttataag |
44136283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #56
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 183 - 277
Target Start/End: Complemental strand, 25139988 - 25139894
Alignment:
| Q |
183 |
tgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataa |
277 |
Q |
| |
|
||||| |||| |||| ||||||| ||| |||||||||||||||||||||| |||||||| ||||||| ||| |||||||||||| ||||||| |
|
|
| T |
25139988 |
tgtccagtgaacataattcagttgttagaacaatgcattattatatgcaggggtcggggttcgaaccccgaacatcccacttattcatcttataa |
25139894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #57
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 28465613 - 28465663
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcaggg |
234 |
Q |
| |
|
|||||||||||||| ||||||||||||| |||||||||||||||||||||| |
|
|
| T |
28465613 |
gtcccgtgagcatagctcagttggtaggacaatgcattattatatgcaggg |
28465663 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #58
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 186 - 268
Target Start/End: Original strand, 29937207 - 29937289
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattc |
268 |
Q |
| |
|
|||||||||||| |||||||||||||| ||| ||| |||||||||||| |||| |||| |||| | |||||||||||||||| |
|
|
| T |
29937207 |
cccgtgagcatagctcagttggtagggacatgtattgttatatgcaggggccggagttcgaacctcagacaccccacttattc |
29937289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #59
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 186 - 281
Target Start/End: Original strand, 31129301 - 31129394
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataagtga |
281 |
Q |
| |
|
||||||| |||| ||||||||| |||| ||||||||||||||||| || |||||||| ||||||||||||||||||||||||| ||| |||||| |
|
|
| T |
31129301 |
cccgtgatcatagctcagttggcagggacaatgcattattatatg---gggtcggggttcgaaccccggacaccccacttattcactttaaaagtga |
31129394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #60
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 178 - 276
Target Start/End: Original strand, 7603720 - 7603824
Alignment:
| Q |
178 |
acaaatgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccg------gggttctaaccccggacaccccacttattcacc |
271 |
Q |
| |
|
|||||||| ||||||||||| || |||| ||||| |||||||||||||||||||| | || |||||| |||||||||||||||||||||||| | |
|
|
| T |
7603720 |
acaaatgttccgtgagcataacttagttcgtaggacaatgcattattatatgcagtggtcggggttcgggttcaaaccccggacaccccacttattcatc |
7603819 |
T |
 |
| Q |
272 |
ttata |
276 |
Q |
| |
|
||||| |
|
|
| T |
7603820 |
ttata |
7603824 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #61
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 205 - 278
Target Start/End: Complemental strand, 10184880 - 10184807
Alignment:
| Q |
205 |
tggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||| ||||||||||||||||| |||||| | ||||| ||| |||||||| ||| |||||||||||||||| |
|
|
| T |
10184880 |
tggtaggacaatgcattattatatgtagggactgaggttcgaactccggacactccatttattcaccttataag |
10184807 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #62
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 213 - 278
Target Start/End: Complemental strand, 13702423 - 13702358
Alignment:
| Q |
213 |
caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||||||||||||||| |||||||| |||| | |||||| ||||||||||||||||||| |
|
|
| T |
13702423 |
caatgcattattatatgcaggggtcggggttcgaacctcagacacctcacttattcaccttataag |
13702358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #63
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 213 - 278
Target Start/End: Complemental strand, 33570500 - 33570435
Alignment:
| Q |
213 |
caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||| ||||||||| || |||||||| |||| |||||||||||||||||||||||||||| |
|
|
| T |
33570500 |
caatgcattgttatatgcatgggtcggggttcgaacctcggacaccccacttattcaccttataag |
33570435 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #64
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 185 - 273
Target Start/End: Complemental strand, 220461 - 220373
Alignment:
| Q |
185 |
tcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
||||||||||||| ||||||||| |||| ||||| | |||||||||| | | |||||| || ||||||||||||||||||||||||| |
|
|
| T |
220461 |
tcccgtgagcatagctcagttggcagggacatgcaatgttatatgcagaggtcagggttcgaatcccggacaccccacttattcacctt |
220373 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #65
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 185 - 273
Target Start/End: Complemental strand, 689616 - 689528
Alignment:
| Q |
185 |
tcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
||||||||||||| ||||||||| |||| ||||| | |||||||||| | | |||||| || ||||||||||||||||||||||||| |
|
|
| T |
689616 |
tcccgtgagcatagctcagttggcagggacatgcaatgttatatgcagaggtcagggttcgaatcccggacaccccacttattcacctt |
689528 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #66
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 185 - 273
Target Start/End: Complemental strand, 734084 - 733996
Alignment:
| Q |
185 |
tcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
||||||||||||| ||||||||| |||| ||||| | |||||||||| | | |||||| || ||||||||||||||||||||||||| |
|
|
| T |
734084 |
tcccgtgagcatagctcagttggcagggacatgcaatgttatatgcagaggtcagggttcgaatcccggacaccccacttattcacctt |
733996 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #67
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 185 - 273
Target Start/End: Complemental strand, 857980 - 857892
Alignment:
| Q |
185 |
tcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
||||||||||||| ||||||||| |||| ||||| | |||||||||| | | |||||| || ||||||||||||||||||||||||| |
|
|
| T |
857980 |
tcccgtgagcatagctcagttggcagggacatgcaatgttatatgcagaggtcagggttcgaatcccggacaccccacttattcacctt |
857892 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #68
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 186 - 281
Target Start/End: Original strand, 5323919 - 5324014
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataagtga |
281 |
Q |
| |
|
||||||||||||| |||||||| || | |||||||||||||||||||||| |||||||| |||||||||| || || |||||||| ||| |||||| |
|
|
| T |
5323919 |
cccgtgagcatac-tcagttggcagtgacaatgcattattatatgcaggggtcggggttcgaaccccggactcctcagttattcactttaaaagtga |
5324014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #69
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 197 - 268
Target Start/End: Original strand, 17110311 - 17110382
Alignment:
| Q |
197 |
acctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattc |
268 |
Q |
| |
|
|||||||||||||||| |||||||||||||||||||||| |||||||| || |||||||| ||||||||||| |
|
|
| T |
17110311 |
acctcagttggtagggacaatgcattattatatgcaggggtcggggttc-aaacccggacatcccacttattc |
17110382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #70
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 183 - 278
Target Start/End: Complemental strand, 44923399 - 44923303
Alignment:
| Q |
183 |
tgtcccgtgagcatacctcagttggtagggcaatgcattatt-atatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||| |||||| |||| ||| || | |||||||||||| |||||||||| |||||||| |||||||||| ||||| ||||||| |||||||| |
|
|
| T |
44923399 |
tgtcccgtcagcatagctcaattgataagacaatgcattatttatatgcaggggtcggggttcgaaccccggactccccatttattcatcttataag |
44923303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #71
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 199 - 278
Target Start/End: Original strand, 24074516 - 24074595
Alignment:
| Q |
199 |
ctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||||||| ||||||||||||||||| |||| | |||| |||| |||||||| ||||||||||||||||||| |
|
|
| T |
24074516 |
ctcagttggtaggacaatgcattattatatgtaggggttgaagttcgaacctcggacacctcacttattcaccttataag |
24074595 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #72
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 200 - 264
Target Start/End: Original strand, 33810653 - 33810718
Alignment:
| Q |
200 |
tcagttggtaggg--caatgcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||||||||||| ||||||||| |||||||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
33810653 |
tcagttggtagggaccaatgcatt-ttatatgcaggggccggggttcaaaccccggacaccccactt |
33810718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #73
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 181 - 264
Target Start/End: Complemental strand, 41089253 - 41089170
Alignment:
| Q |
181 |
aatgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||||||| ||| ||| || |||||||||| |||||||||||||||||||||| ||||||| ||| ||||||||| ||||| |
|
|
| T |
41089253 |
aatgtcccgcgagtatagcttagttggtaggacaatgcattattatatgcaggggtcggggtttgaacaccggacacctcactt |
41089170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #74
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 203 - 274
Target Start/End: Complemental strand, 42762111 - 42762040
Alignment:
| Q |
203 |
gttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctta |
274 |
Q |
| |
|
|||| |||| |||||||||| ||||||||||| || ||||| || |||||||||||||||||||||||||| |
|
|
| T |
42762111 |
gttgataggacaatgcattactatatgcaggggtcgaggttcaaatcccggacaccccacttattcacctta |
42762040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #75
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 183 - 269
Target Start/End: Original strand, 8682375 - 8682461
Alignment:
| Q |
183 |
tgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattca |
269 |
Q |
| |
|
||||||||||||||| ||||||||||||| |||| | ||||||||||||||| || |||| ||||||||||| || |||||||| |
|
|
| T |
8682375 |
tgtcccgtgagcatagctcagttggtaggacaattctttattatatgcaggggttggagttcgaaccccggacagtccccttattca |
8682461 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #76
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 183 - 229
Target Start/End: Complemental strand, 41225766 - 41225720
Alignment:
| Q |
183 |
tgtcccgtgagcatacctcagttggtagggcaatgcattattatatg |
229 |
Q |
| |
|
||||||||||||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
41225766 |
tgtcccgtgagcatagctcagttggtaggacaatgcattattatatg |
41225720 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #77
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 213 - 278
Target Start/End: Complemental strand, 13537382 - 13537317
Alignment:
| Q |
213 |
caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||| ||||||||||| |||||||| |||||| ||||||||||||||||| |||||||| |
|
|
| T |
13537382 |
caatgcattgttatatgcaggtgtcggggttcgaaccccagacaccccacttattcatcttataag |
13537317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #78
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 213 - 278
Target Start/End: Complemental strand, 13626930 - 13626865
Alignment:
| Q |
213 |
caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||| ||||||||||| |||||||| |||||| ||||||||||||||||| |||||||| |
|
|
| T |
13626930 |
caatgcattgttatatgcaggtgtcggggttcgaaccccagacaccccacttattcatcttataag |
13626865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #79
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 189 - 274
Target Start/End: Complemental strand, 14011133 - 14011048
Alignment:
| Q |
189 |
gtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctta |
274 |
Q |
| |
|
||||||||| |||||||| |||| ||||||| |||||||||||| |||| |||| |||| |||||| |||||||||||| |||| |
|
|
| T |
14011133 |
gtgagcatagttcagttggcagggacatgcattgttatatgcaggggccggagttcgaacctcggacatcccacttattcatctta |
14011048 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #80
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 186 - 270
Target Start/End: Complemental strand, 23178961 - 23178877
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaat-gcattattatatgcagggaccggggttctaaccccggacaccccacttattcac |
270 |
Q |
| |
|
||||||||| || |||||||||||||| || |||| ||||||||||||| ||||||||| |||||||||||| |||||| ||||| |
|
|
| T |
23178961 |
cccgtgagcttagctcagttggtagggatattgcat-attatatgcaggggccggggttcgaaccccggacactccacttcttcac |
23178877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #81
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 184 - 229
Target Start/End: Original strand, 29108657 - 29108702
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatg |
229 |
Q |
| |
|
|||||||||||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
29108657 |
gtcccgtgagcatagctcagttggtaggacaatgcattattatatg |
29108702 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #82
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 213 - 278
Target Start/End: Original strand, 30542788 - 30542853
Alignment:
| Q |
213 |
caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||| ||||||||||||| |||||||| ||||||| ||| ||| |||||||||||||||| |
|
|
| T |
30542788 |
caatgcattgttatatgcagggatcggggttcgaaccccgaacattccatttattcaccttataag |
30542853 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #83
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 226 - 278
Target Start/End: Original strand, 11822999 - 11823051
Alignment:
| Q |
226 |
tatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||| |||| |||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
11822999 |
tatgtaggggccggggtttgaaccccggacaccccacttattcaccttataag |
11823051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #84
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 226 - 270
Target Start/End: Original strand, 17855686 - 17855730
Alignment:
| Q |
226 |
tatgcagggaccggggttctaaccccggacaccccacttattcac |
270 |
Q |
| |
|
||||||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
17855686 |
tatgcaggggccggggttcgaaccccggacaccccacttattcac |
17855730 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #85
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 221 - 273
Target Start/End: Complemental strand, 19957384 - 19957332
Alignment:
| Q |
221 |
tattatatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
|||||||||||||| || ||||| |||||||||||||||||||||||||||| |
|
|
| T |
19957384 |
tattatatgcaggggacgaggttcgaaccccggacaccccacttattcacctt |
19957332 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #86
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 186 - 274
Target Start/End: Original strand, 28979023 - 28979111
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctta |
274 |
Q |
| |
|
|||||||||||| ||||||| ||||| ||||||| ||||||| |||| ||| ||| ||||||||||||| ||||||||||||||| |
|
|
| T |
28979023 |
cccgtgagcatagttcagttgatagggacatgcattgttatatgtaggggtcggaattcgaaccccggacacctcacttattcacctta |
28979111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #87
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 186 - 270
Target Start/End: Complemental strand, 39432426 - 39432342
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcac |
270 |
Q |
| |
|
|||||||||||| ||||||||| |||| ||||| | |||||||||||| ||||||| |||| | |||||||||||||||||| |
|
|
| T |
39432426 |
cccgtgagcatagctcagttggcagggacatgcaatgttatatgcaggggttggggttcgaacctcagacaccccacttattcac |
39432342 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #88
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 186 - 264
Target Start/End: Original strand, 481011 - 481089
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||||||| || |||||||||||||| || ||||| ||| ||||||||| ||| ||||| ||||||||||||||||||| |
|
|
| T |
481011 |
cccgtgagcttagctcagttggtagggacattgcataatt-tatgcaggggccgcggttcgaaccccggacaccccactt |
481089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #89
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 186 - 264
Target Start/End: Complemental strand, 13059247 - 13059169
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||||||| || |||||||||||||| |||||||| ||| ||||||||| | ||||||| |||||| |||||||||||| |
|
|
| T |
13059247 |
cccgtgagcttagctcagttggtagggacaatgcataatt-tatgcaggggcaggggttcgaacccctgacaccccactt |
13059169 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #90
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 186 - 273
Target Start/End: Complemental strand, 25470944 - 25470857
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
|||||||||||| |||||||| ||| |||||||||||||| || || |||||||| |||| ||||||||||| ||||||||||| |
|
|
| T |
25470944 |
cccgtgagcataactcagttgacaggaacatgcattattatattcatgggtcggggttcgaacctcggacaccccatttattcacctt |
25470857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #91
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 29514204 - 29514255
Alignment:
| Q |
183 |
tgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcaggg |
234 |
Q |
| |
|
||||| ||||||||| ||||||||||||| |||||| ||||||||||||||| |
|
|
| T |
29514204 |
tgtcctgtgagcatagctcagttggtaggacaatgctttattatatgcaggg |
29514255 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #92
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 221 - 264
Target Start/End: Original strand, 34761002 - 34761045
Alignment:
| Q |
221 |
tattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||||||||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
34761002 |
tattatatgcagggaccggagttcgaaccccggacaccccactt |
34761045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #93
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 221 - 264
Target Start/End: Original strand, 34894404 - 34894447
Alignment:
| Q |
221 |
tattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
34894404 |
tattatatgcaggggccggggttcgaaccccggacaccccactt |
34894447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #94
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 186 - 277
Target Start/End: Complemental strand, 41616436 - 41616345
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataa |
277 |
Q |
| |
|
|||||||||||| |||||||||||||| || |||||||||||||| ||||||||| ||||||||| || |||||| | ||| |||||| |
|
|
| T |
41616436 |
cccgtgagcataactcagttggtagggatattgtatattatatgcaggggccggggttcgaaccccggatactccacttctccacattataa |
41616345 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #95
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 186 - 264
Target Start/End: Complemental strand, 43856452 - 43856374
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaat-gcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||||||| || |||||||||||||| || ||||| |||||||||||| ||||||||| |||||||||||| |||||| |
|
|
| T |
43856452 |
cccgtgagcttaactcagttggtagggatattgcatt-ttatatgcaggggccggggttcgaaccccggacactccactt |
43856374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #96
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 186 - 264
Target Start/End: Original strand, 6280480 - 6280558
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||||||| || |||||||||||||| || | ||||||||||||| ||||||||| |||||||||||| |||||| |
|
|
| T |
6280480 |
cccgtgagcttagctcagttggtagggatattgaatattatatgcaggagccggggttcgaaccccggacactccactt |
6280558 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #97
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 191 - 277
Target Start/End: Original strand, 6978822 - 6978908
Alignment:
| Q |
191 |
gagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataa |
277 |
Q |
| |
|
||||||| ||||||| |||| ||||||||||||||||||||| ||||||| |||| || |||| ||| ||||||||||||||| |
|
|
| T |
6978822 |
gagcataattcagttgataggataatgcattattatatgcaggggttggggttcgaaccacgaacactccatttattcaccttataa |
6978908 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #98
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 223 - 277
Target Start/End: Original strand, 23239158 - 23239212
Alignment:
| Q |
223 |
ttatatgcagggaccggggttctaaccccggacaccccacttattcaccttataa |
277 |
Q |
| |
|
||||||| |||| ||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
23239158 |
ttatatgtaggggtcggggtttgaaccccggacaccccacttattcaccttataa |
23239212 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #99
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 182 - 228
Target Start/End: Complemental strand, 25689549 - 25689503
Alignment:
| Q |
182 |
atgtcccgtgagcatacctcagttggtagggcaatgcattattatat |
228 |
Q |
| |
|
|||||||||||||||| |||||||||| || |||||||||||||||| |
|
|
| T |
25689549 |
atgtcccgtgagcatagctcagttggttggacaatgcattattatat |
25689503 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #100
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 193 - 278
Target Start/End: Complemental strand, 40329696 - 40329610
Alignment:
| Q |
193 |
gcatacctcagttggtagggcaatgcattattatatgca-gggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||| ||||||||||||| |||||||||||||||||| ||| | | ||||| || | ||||||||| |||||||||| ||||||| |
|
|
| T |
40329696 |
gcataactcagttggtaggataatgcattattatatgcatgggtcggaggttcgaatctcggacaccctacttattcactttataag |
40329610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #101
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 224 - 274
Target Start/End: Complemental strand, 43508508 - 43508458
Alignment:
| Q |
224 |
tatatgcagggaccggggttctaaccccggacaccccacttattcacctta |
274 |
Q |
| |
|
|||||| |||| |||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
43508508 |
tatatgtaggggccggggtttgaaccccggacaccccacttattcacctta |
43508458 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #102
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 188 - 264
Target Start/End: Complemental strand, 15856574 - 15856498
Alignment:
| Q |
188 |
cgtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||||| || |||||||||||||| || ||||| ||| ||| ||||||||||||||| |||| |||||||||||||| |
|
|
| T |
15856574 |
cgtgagcttaactcagttggtagggacattgcataatt-tatacagggaccggggttcaaacctcggacaccccactt |
15856498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #103
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 186 - 258
Target Start/End: Complemental strand, 21133618 - 21133545
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacacc |
258 |
Q |
| |
|
|||||||||||| ||||||||| ||| ||||||||||||||||||||| |||||||| |||||| |||||| |
|
|
| T |
21133618 |
cccgtgagcataactcagttggcaggaacaatgcattattatatgcaggagtcggggttcgaaccccagacacc |
21133545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #104
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 186 - 270
Target Start/End: Complemental strand, 36815562 - 36815478
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcac |
270 |
Q |
| |
|
|||||||||||| |||||||| || | |||||||||||||||| ||| ||||||| ||| ||| ||||| ||||||||||||||| |
|
|
| T |
36815562 |
cccgtgagcatagctcagttgacagagacaatgcattattatatacagcgaccgggattcgaactccgga-accccacttattcac |
36815478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #105
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 186 - 278
Target Start/End: Original strand, 37154510 - 37154603
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||||| || |||||| || | |||||||| |||||||||||| ||| ||| ||||| |||||||||| |||||||||||||||| |
|
|
| T |
37154510 |
cccgtgagcatagcttagttggcagagacaatgcatcgttatatgcaggggtcggaattcgaaccctggacaccccatttattcaccttataag |
37154603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #106
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 228 - 269
Target Start/End: Complemental strand, 41454883 - 41454842
Alignment:
| Q |
228 |
tgcagggaccggggttctaaccccggacaccccacttattca |
269 |
Q |
| |
|
||||||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
41454883 |
tgcaggggccggggttcgaaccccggacaccccacttattca |
41454842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #107
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 185 - 273
Target Start/End: Complemental strand, 216246 - 216158
Alignment:
| Q |
185 |
tcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
||||||||||||| ||||||||| |||| || |||| |||||||||| | | |||||| || | |||||||| |||||||||||||| |
|
|
| T |
216246 |
tcccgtgagcatagctcagttggcagggacatacattgttatatgcagaggtcagggttcgaatcacggacacctcacttattcacctt |
216158 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #108
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 185 - 273
Target Start/End: Complemental strand, 692806 - 692718
Alignment:
| Q |
185 |
tcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
||||||||||||| ||||||||| |||| || |||| |||||||||| | | |||||| || | |||||||| |||||||||||||| |
|
|
| T |
692806 |
tcccgtgagcatagctcagttggcagggacatacattgttatatgcagaggtcagggttcgaatcacggacacctcacttattcacctt |
692718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #109
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 185 - 273
Target Start/End: Complemental strand, 697015 - 696927
Alignment:
| Q |
185 |
tcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
||||||||||||| ||||||||| |||| || |||| |||||||||| | | |||||| || | |||||||| |||||||||||||| |
|
|
| T |
697015 |
tcccgtgagcatagctcagttggcagggacatacattgttatatgcagaggtcagggttcgaatcacggacacctcacttattcacctt |
696927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #110
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 185 - 273
Target Start/End: Complemental strand, 729869 - 729781
Alignment:
| Q |
185 |
tcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
||||||||||||| ||||||||| |||| || |||| |||||||||| | | |||||| || | |||||||| |||||||||||||| |
|
|
| T |
729869 |
tcccgtgagcatagctcagttggcagggacatacattgttatatgcagaggtcagggttcgaatcacggacacctcacttattcacctt |
729781 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #111
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 185 - 273
Target Start/End: Complemental strand, 853764 - 853676
Alignment:
| Q |
185 |
tcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
||||||||||||| ||||||||| |||| || |||| |||||||||| | | |||||| || | |||||||| |||||||||||||| |
|
|
| T |
853764 |
tcccgtgagcatagctcagttggcagggacatacattgttatatgcagaggtcagggttcgaatcacggacacctcacttattcacctt |
853676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #112
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 226 - 274
Target Start/End: Original strand, 3311477 - 3311525
Alignment:
| Q |
226 |
tatgcagggaccggggttctaaccccggacaccccacttattcacctta |
274 |
Q |
| |
|
|||||||||| | |||||| |||||||||||||||||||||||| |||| |
|
|
| T |
3311477 |
tatgcagggatcagggttcgaaccccggacaccccacttattcatctta |
3311525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #113
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 213 - 281
Target Start/End: Complemental strand, 18009786 - 18009718
Alignment:
| Q |
213 |
caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataagtga |
281 |
Q |
| |
|
|||||||||||||||||||||| ||||||||| || |||| | || ||||||||||| ||| |||||| |
|
|
| T |
18009786 |
caatgcattattatatgcagggtccggggttcgaatcccgaatacttcacttattcactttaaaagtga |
18009718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #114
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 218 - 278
Target Start/End: Original strand, 33982219 - 33982279
Alignment:
| Q |
218 |
cattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||| |||||||||||| |||||||| |||||| |||||| ||||||||||| ||||||| |
|
|
| T |
33982219 |
cattgttatatgcaggggtcggggttcgaaccccagacaccgcacttattcactttataag |
33982279 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #115
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 221 - 264
Target Start/End: Original strand, 2792814 - 2792857
Alignment:
| Q |
221 |
tattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||||||| |||||| |
|
|
| T |
2792814 |
tattatatgcaggggccggggttcgaaccccggacactccactt |
2792857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #116
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 221 - 264
Target Start/End: Complemental strand, 5328602 - 5328559
Alignment:
| Q |
221 |
tattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||||||||| ||||| |
|
|
| T |
5328602 |
tattatatgcaggggccggggttcgaaccccggacacctcactt |
5328559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #117
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 186 - 264
Target Start/End: Complemental strand, 8034482 - 8034404
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaat-gcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||||||| || |||||||||||||| || |||| ||||||||||||| ||||||||| ||| || |||||||||||| |
|
|
| T |
8034482 |
cccgtgagcttaactcagttggtagggatattgcat-attatatgcaggggccggggttcgaacaccagacaccccactt |
8034404 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #118
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 223 - 270
Target Start/End: Complemental strand, 10309721 - 10309674
Alignment:
| Q |
223 |
ttatatgcagggaccggggttctaaccccggacaccccacttattcac |
270 |
Q |
| |
|
|||||||||||| |||||||| ||||||| ||||||||||||||||| |
|
|
| T |
10309721 |
ttatatgcaggggtcggggttcaaaccccgaacaccccacttattcac |
10309674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #119
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 186 - 264
Target Start/End: Complemental strand, 10736944 - 10736866
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaat-gcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||||||| || |||||||||||||| || |||| |||||||||||| ||||||||| |||||||||||| |||||| |
|
|
| T |
10736944 |
cccgtgagcttagctcagttggtagggatattgcat-attatatgcaggagccggggttcgaaccccggacactccactt |
10736866 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #120
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 190 - 264
Target Start/End: Original strand, 12770372 - 12770446
Alignment:
| Q |
190 |
tgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||| || |||||||| ||||| || ||||| ||| ||||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
12770372 |
tgagcttagctcagttgatagggacattgcataatt-tatgcaggggccggggttcgaaccccggacaccccactt |
12770446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #121
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 186 - 264
Target Start/End: Complemental strand, 14876672 - 14876594
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaat-gcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||||||| || |||||||||||||| ||| |||| |||||||||||| ||||||||| |||| ||||||| |||||| |
|
|
| T |
14876672 |
cccgtgagcttagctcagttggtagggaaattgcat-attatatgcaggagccggggttcgaacctcggacactccactt |
14876594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #122
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 221 - 264
Target Start/End: Complemental strand, 17072598 - 17072555
Alignment:
| Q |
221 |
tattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||| ||||||||||| |
|
|
| T |
17072598 |
tattatatgcaggggccggggttcgaaccccgaacaccccactt |
17072555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #123
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 221 - 264
Target Start/End: Original strand, 17575673 - 17575716
Alignment:
| Q |
221 |
tattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||| ||||||||||| |
|
|
| T |
17575673 |
tattatatgcaggggccggggttcgaaccccgaacaccccactt |
17575716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #124
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 221 - 264
Target Start/End: Complemental strand, 22274646 - 22274603
Alignment:
| Q |
221 |
tattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||||||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
22274646 |
tattatatgcaggagccggggttcgaaccccggacaccccactt |
22274603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #125
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 187 - 281
Target Start/End: Original strand, 22426398 - 22426493
Alignment:
| Q |
187 |
ccgtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataagtga |
281 |
Q |
| |
|
||||||||||| |||| ||| |||| ||||||||||||||||| |||| | ||||| |||||| ||||||||| |||||||| ||| |||||| |
|
|
| T |
22426398 |
ccgtgagcataactcaattgacagggacaatgcattattatatgtaggggttgaggttcgaacccctgacaccccatttattcactttaaaagtga |
22426493 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #126
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 225 - 264
Target Start/End: Original strand, 23261340 - 23261379
Alignment:
| Q |
225 |
atatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
|||||||||||||||||||| |||||||||||| |||||| |
|
|
| T |
23261340 |
atatgcagggaccggggttcgaaccccggacactccactt |
23261379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #127
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 186 - 264
Target Start/End: Original strand, 26022247 - 26022325
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaat-gcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||||||| || |||||||||||||| || |||| ||||||||||||| ||||||||| |||||| ||||| |||||| |
|
|
| T |
26022247 |
cccgtgagcttagctcagttggtagggatattgcat-attatatgcaggggccggggttcgaaccccagacactccactt |
26022325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #128
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 215 - 274
Target Start/End: Original strand, 29653080 - 29653139
Alignment:
| Q |
215 |
atgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctta |
274 |
Q |
| |
|
||||||||||||||||||||| || ||||| ||| || | ||| |||||||||||||||| |
|
|
| T |
29653080 |
atgcattattatatgcagggatcgtggttcgaactcctgccactccacttattcacctta |
29653139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #129
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 186 - 264
Target Start/End: Original strand, 29716860 - 29716938
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaat-gcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||||||| || |||||||||||||| || |||| |||||||||||| ||||||||| |||||||||||| |||||| |
|
|
| T |
29716860 |
cccgtgagcttagctcagttggtagggatattgcat-attatatgcaggagccggggttcgaaccccggacactccactt |
29716938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #130
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 186 - 264
Target Start/End: Original strand, 34413062 - 34413140
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaat-gcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||||||| || |||||||||||||| || |||| |||||||||||| ||||||||| |||||||||||| |||||| |
|
|
| T |
34413062 |
cccgtgagcttagctcagttggtagggatattgcat-attatatgcaggagccggggttcgaaccccggacactccactt |
34413140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #131
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 186 - 264
Target Start/End: Original strand, 35939487 - 35939565
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaat-gcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||||||| || |||||||||||||| || |||| ||||||||||||| ||||||||| |||| ||||||||||||| |
|
|
| T |
35939487 |
cccgtgagcttagctcagttggtagggatattgcat-attatatgcaggggccggggttcaaaccgtggacaccccactt |
35939565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #132
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 221 - 264
Target Start/End: Original strand, 37290957 - 37291000
Alignment:
| Q |
221 |
tattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
|||||||||||||| |||| |||| ||||||||||||||||||| |
|
|
| T |
37290957 |
tattatatgcaggggccggcgttcgaaccccggacaccccactt |
37291000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #133
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 186 - 264
Target Start/End: Original strand, 37717363 - 37717441
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaat-gcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||||||| || |||||||||||||| || |||| |||||||||||| ||||||||| |||||||||||| |||||| |
|
|
| T |
37717363 |
cccgtgagcttaactcagttggtagggatattgcat-attatatgcaggagccggggttcgaaccccggacactccactt |
37717441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #134
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 186 - 264
Target Start/End: Complemental strand, 38219638 - 38219560
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaat-gcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
|||||||||||| |||||||||||||| || |||| |||||||||||| |||||||| |||||||||||| |||||| |
|
|
| T |
38219638 |
cccgtgagcatagctcagttggtagggatattgcat-attatatgcaggagtcggggttcgaaccccggacactccactt |
38219560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #135
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 186 - 257
Target Start/End: Complemental strand, 38955264 - 38955193
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacac |
257 |
Q |
| |
|
||||||||| || |||||||||||||| || |||||||||||||| ||||||||| |||||||||||| |
|
|
| T |
38955264 |
cccgtgagcttaactcagttggtagggatattacatattatatgcaggggccggggttcgaaccccggacac |
38955193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #136
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 221 - 264
Target Start/End: Original strand, 44444579 - 44444622
Alignment:
| Q |
221 |
tattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
|||||||||||||| | ||||||| ||||||||||||||||||| |
|
|
| T |
44444579 |
tattatatgcaggggctggggttcgaaccccggacaccccactt |
44444622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #137
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 223 - 273
Target Start/End: Original strand, 574259 - 574308
Alignment:
| Q |
223 |
ttatatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||| |||||||||||||||| |
|
|
| T |
574259 |
ttatatgcaggggtcggggttcgaaccccggaca-cccacttattcacctt |
574308 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #138
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 187 - 264
Target Start/End: Complemental strand, 2787150 - 2787073
Alignment:
| Q |
187 |
ccgtgagcatacctcagttggtagggcaat-gcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
|||||||| || |||||||||||||| || |||| |||||||||||| ||||||||| |||||||||||| |||||| |
|
|
| T |
2787150 |
ccgtgagcttagctcagttggtagggatattgcat-attatatgcaggagccggggttcgaaccccggacactccactt |
2787073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #139
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 186 - 264
Target Start/End: Original strand, 7797130 - 7797208
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||| ||| || |||||||||||||| || | ||||||||||||| ||||||||| |||||||||||| |||||| |
|
|
| T |
7797130 |
cccgtaagcttagctcagttggtagggatattgaatattatatgcaggagccggggttcgaaccccggacactccactt |
7797208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #140
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 224 - 278
Target Start/End: Original strand, 8350471 - 8350525
Alignment:
| Q |
224 |
tatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||||| |||| |||| |||| ||||||||||||||||||| ||| |||| |
|
|
| T |
8350471 |
tatatgcaggggccggagttcgaacctcggacaccccacttattcatcttttaag |
8350525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #141
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 187 - 264
Target Start/End: Original strand, 10083164 - 10083241
Alignment:
| Q |
187 |
ccgtgagcatacctcagttggtagggcaat-gcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
|||||||| || |||||||||||||| || |||| ||||||||||||| || ||||| ||||||||||||||||||| |
|
|
| T |
10083164 |
ccgtgagcttaactcagttggtagggatattgcat-attatatgcaggggtcgaggttcgaaccccggacaccccactt |
10083241 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #142
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 226 - 264
Target Start/End: Original strand, 11231460 - 11231498
Alignment:
| Q |
226 |
tatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
11231460 |
tatgcaggggccggggttcgaaccccggacaccccactt |
11231498 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #143
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 185 - 274
Target Start/End: Complemental strand, 16808460 - 16808370
Alignment:
| Q |
185 |
tcccgtgagcatacctcagttggtagggcaatgcattattatatgca-gggaccggggttctaaccccggacaccccacttattcacctta |
274 |
Q |
| |
|
|||| |||||||| ||||||| | |||| ||||||||||||||||| ||| ||||||| |||||| ||| ||||||||||||||||| |
|
|
| T |
16808460 |
tcccatgagcataactcagttagcagggacatgcattattatatgcaggggtggggggttcgaaccccatacagcccacttattcacctta |
16808370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #144
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 181 - 278
Target Start/End: Original strand, 23964649 - 23964743
Alignment:
| Q |
181 |
aatgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||||| ||| |||||||||| | |||||||||||||||||||||| ||| |||| ||| ||| ||||| ||||||||| | ||||||| |
|
|
| T |
23964649 |
aatgtcccgtgaatataactcagttggt--gacaatgcattattatatgcaggggccgaggtt-taaatccgaacacctcacttattctctttataag |
23964743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #145
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 184 - 278
Target Start/End: Original strand, 30461531 - 30461625
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||| |||||| |||| |||||||| || | |||||||||||||| | ||||||| ||| || |||| | ||||||||||||||||||| |
|
|
| T |
30461531 |
gtcccgtaagcatagctcaattggtaggataaggtattattatatgcagcacctggggttcgaactccagacatctcacttattcaccttataag |
30461625 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #146
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 36467984 - 36467934
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcaggg |
234 |
Q |
| |
|
||||||||| ||| ||||||||||| | |||||||||||||||||||||| |
|
|
| T |
36467984 |
gtcccgtgattatagctcagttggtatgacaatgcattattatatgcaggg |
36467934 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #147
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 228 - 274
Target Start/End: Original strand, 45536757 - 45536803
Alignment:
| Q |
228 |
tgcagggaccggggttctaaccccggacaccccacttattcacctta |
274 |
Q |
| |
|
||||||| |||| |||| |||||||||||||||||||||||| |||| |
|
|
| T |
45536757 |
tgcaggggccggagttcgaaccccggacaccccacttattcatctta |
45536803 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #148
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 221 - 270
Target Start/End: Original strand, 1503944 - 1503993
Alignment:
| Q |
221 |
tattatatgcagggaccggggttctaaccccggacaccccacttattcac |
270 |
Q |
| |
|
||||||||||||| ||||||||| |||||| |||||||||||| ||||| |
|
|
| T |
1503944 |
tattatatgcaggagccggggttcgaaccccagacaccccacttcttcac |
1503993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #149
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 228 - 269
Target Start/End: Original strand, 4259898 - 4259939
Alignment:
| Q |
228 |
tgcagggaccggggttctaaccccggacaccccacttattca |
269 |
Q |
| |
|
||||||| ||||||||| |||||||||| ||||||||||||| |
|
|
| T |
4259898 |
tgcaggggccggggttccaaccccggactccccacttattca |
4259939 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #150
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 213 - 266
Target Start/End: Original strand, 4293907 - 4293960
Alignment:
| Q |
213 |
caatgcattattatatgcagggaccggggttctaaccccggacaccccacttat |
266 |
Q |
| |
|
|||||||||||||||||||||| |||||||| |||||| |||| |||| |||| |
|
|
| T |
4293907 |
caatgcattattatatgcaggggtcggggttcgaaccccagacatcccatttat |
4293960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #151
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 223 - 264
Target Start/End: Original strand, 7453389 - 7453430
Alignment:
| Q |
223 |
ttatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||||| |||| ||||||||| ||||||||||||||||||| |
|
|
| T |
7453389 |
ttatatgtaggggccggggttcgaaccccggacaccccactt |
7453430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #152
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 192 - 280
Target Start/End: Complemental strand, 14352907 - 14352818
Alignment:
| Q |
192 |
agcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataagtg |
280 |
Q |
| |
|
|||||| |||| |||| |||| || |||||||||||||| | || |||| |||| |||| | |||||| || |||||||||||||||||| |
|
|
| T |
14352907 |
agcatagctcaattggcagggacagtgcattattatatgtaagggccggagttcgaacctcagacacctcatttattcaccttataagtg |
14352818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #153
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 221 - 270
Target Start/End: Complemental strand, 23339931 - 23339882
Alignment:
| Q |
221 |
tattatatgcagggaccggggttctaaccccggacaccccacttattcac |
270 |
Q |
| |
|
||||||||| |||| ||||||||| ||||| ||||||||||||| ||||| |
|
|
| T |
23339931 |
tattatatgtaggggccggggttcgaaccctggacaccccacttcttcac |
23339882 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #154
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 223 - 264
Target Start/End: Original strand, 37708728 - 37708769
Alignment:
| Q |
223 |
ttatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
|||||||||||| ||||||||| ||||||||||| ||||||| |
|
|
| T |
37708728 |
ttatatgcaggggccggggttcgaaccccggacatcccactt |
37708769 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #155
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 183 - 228
Target Start/End: Complemental strand, 40329306 - 40329261
Alignment:
| Q |
183 |
tgtcccgtgagcatacctcagttggtagggcaatgcattattatat |
228 |
Q |
| |
|
||||||||||||||| ||| |||||||| |||||||||||||||| |
|
|
| T |
40329306 |
tgtcccgtgagcatagctcggttggtagaacaatgcattattatat |
40329261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #156
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 223 - 264
Target Start/End: Complemental strand, 43085256 - 43085215
Alignment:
| Q |
223 |
ttatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
|||||||||||| ||||||||| |||||||||||| |||||| |
|
|
| T |
43085256 |
ttatatgcaggggccggggttcgaaccccggacactccactt |
43085215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #157
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 224 - 264
Target Start/End: Complemental strand, 2908123 - 2908083
Alignment:
| Q |
224 |
tatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||||||||| ||||||||| ||||| ||||||||||||| |
|
|
| T |
2908123 |
tatatgcaggggccggggttcgaaccctggacaccccactt |
2908083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #158
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 213 - 281
Target Start/End: Original strand, 10310306 - 10310374
Alignment:
| Q |
213 |
caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataagtga |
281 |
Q |
| |
|
|||||||||||||||| ||| | ||| ||| || |||||||||||||||||||||| ||| |||||| |
|
|
| T |
10310306 |
caatgcattattatatacagaggtcggagtttgaatcccggacaccccacttattcactttaaaagtga |
10310374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #159
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 214 - 274
Target Start/End: Complemental strand, 13106440 - 13106380
Alignment:
| Q |
214 |
aatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctta |
274 |
Q |
| |
|
|||||||| ||||||||| || ||| |||| |||||||||||||| | |||||||||||| |
|
|
| T |
13106440 |
aatgcattgttatatgcatgggtcggtgttcaaaccccggacacccaatttattcacctta |
13106380 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #160
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 226 - 278
Target Start/End: Complemental strand, 14684274 - 14684222
Alignment:
| Q |
226 |
tatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||| |||| ||||||||| ||| ||||||||||||||||||| |||||||| |
|
|
| T |
14684274 |
tatgtaggggccggggttcgaacttcggacaccccacttattcatcttataag |
14684222 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #161
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 186 - 274
Target Start/End: Complemental strand, 22438682 - 22438594
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctta |
274 |
Q |
| |
|
|||||||||||| ||||||| | | || ||||||| |||||| |||||| | |||| ||| |||||||| |||||||||||||||| |
|
|
| T |
22438682 |
cccgtgagcatatctcagttagaatggacatgcattgttatattttgggaccagagttcaaactccggacactccacttattcacctta |
22438594 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #162
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 202 - 274
Target Start/End: Complemental strand, 22847344 - 22847272
Alignment:
| Q |
202 |
agttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctta |
274 |
Q |
| |
|
|||||| |||| ||||||| |||||||||||| || ||||| |||||| ||||| ||||||||||||||| |
|
|
| T |
22847344 |
agttggcagggacatgcattgttatatgcaggggtcgaggttcgaaccccacacacctcacttattcacctta |
22847272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #163
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 189 - 264
Target Start/End: Complemental strand, 25890471 - 25890396
Alignment:
| Q |
189 |
gtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
|||||| || || ||||||||||| || ||||| ||| |||||| || ||||||||| ||||||||||||||||||| |
|
|
| T |
25890471 |
gtgagcttagcttagttggtagggacattgcataatt-tatgcaagggccggggttcgaaccccggacaccccactt |
25890396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #164
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 189 - 264
Target Start/End: Complemental strand, 27077164 - 27077089
Alignment:
| Q |
189 |
gtgagcatacctcagttggtagggcaat-gcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
|||||| || |||||||||||||| || |||| ||||||||||||| |||||||| || |||||||||||||||| |
|
|
| T |
27077164 |
gtgagcttagctcagttggtagggatattgcat-attatatgcaggggtcggggttcgaatcccggacaccccactt |
27077089 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #165
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 218 - 274
Target Start/End: Complemental strand, 27821971 - 27821915
Alignment:
| Q |
218 |
cattattatatgcagggaccggggttctaaccccggacaccccacttattcacctta |
274 |
Q |
| |
|
|||||||||||| ||||| |||||||| || ||| ||||| ||||||||||||||| |
|
|
| T |
27821971 |
cattattatatggagggatcggggttcaaatcccacacacctcacttattcacctta |
27821915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #166
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 237 - 269
Target Start/End: Complemental strand, 43456699 - 43456667
Alignment:
| Q |
237 |
cggggttctaaccccggacaccccacttattca |
269 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| |
|
|
| T |
43456699 |
cggggttcgaaccccggacaccccacttattca |
43456667 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #167
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 221 - 257
Target Start/End: Complemental strand, 43980348 - 43980312
Alignment:
| Q |
221 |
tattatatgcagggaccggggttctaaccccggacac |
257 |
Q |
| |
|
||||||||||||||| |||||||| |||||||||||| |
|
|
| T |
43980348 |
tattatatgcagggatcggggttcgaaccccggacac |
43980312 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr8; HSP #168
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 200 - 278
Target Start/End: Complemental strand, 44361018 - 44360943
Alignment:
| Q |
200 |
tcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||||| ||||||||||| |||||||| ||||||| ||||||| || ||||||||| ||||||||||| |
|
|
| T |
44361018 |
tcagttggtaggacaatgcattat---atgcaggggttggggttcgaaccccgatcatcccacttatccaccttataag |
44360943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6 (Bit Score: 76; Significance: 4e-35; HSPs: 146)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 183 - 278
Target Start/End: Complemental strand, 9491836 - 9491741
Alignment:
| Q |
183 |
tgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||||||||| ||||||||||||| ||||||||||||||||| |||| ||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
9491836 |
tgtcccgtgagcataactcagttggtaggacaatgcattattatatgtaggggccggggttcgaaccccggacaccccacttattcaccttataag |
9491741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 183 - 278
Target Start/End: Original strand, 12089091 - 12089186
Alignment:
| Q |
183 |
tgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||||||||| ||||||||||||| |||||||||||||||||||||| |||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
12089091 |
tgtcccgtgagcatagctcagttggtaggacaatgcattattatatgcaggggccggagttcgaaccccggacaccccacttattcaccttataag |
12089186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 183 - 278
Target Start/End: Complemental strand, 22389851 - 22389756
Alignment:
| Q |
183 |
tgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||||||||| ||||||||||||| |||||||||||||||||||||| | |||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
22389851 |
tgtcccgtgagcatagctcagttggtaggacaatgcattattatatgcaggggtcagggttcgaatcccggacaccccacttattcaccttataag |
22389756 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 184 - 278
Target Start/End: Complemental strand, 7563676 - 7563582
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||||||| ||||||||||||| ||||||||||||| |||||||| | |||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
7563676 |
gtcccgtgagcatagctcagttggtaggacaatgcattattacatgcaggggtcagggttcaaaccccggacaccccacttattcaccttataag |
7563582 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 183 - 278
Target Start/End: Complemental strand, 10377225 - 10377130
Alignment:
| Q |
183 |
tgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||||| ||| ||||||||||||| |||||||||||||||||||| | ||||||||| ||||||| ||||||||||||||||| ||||||| |
|
|
| T |
10377225 |
tgtcccgtgagtatagctcagttggtaggacaatgcattattatatgcagaggccggggttcgaaccccgaacaccccacttattcacgttataag |
10377130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 186 - 281
Target Start/End: Complemental strand, 14981801 - 14981705
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataagtga |
281 |
Q |
| |
|
|||||||||||| ||||||||| |||| |||||||||||||||||||||| ||||||||| ||||| ||||||||||||||||||| ||| |||||| |
|
|
| T |
14981801 |
cccgtgagcatagctcagttggcagggacaatgcattattatatgcaggggccggggttcgaaccctggacaccccacttattcactttaaaagtga |
14981705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #7
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 190 - 278
Target Start/End: Complemental strand, 25020622 - 25020534
Alignment:
| Q |
190 |
tgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||| ||||| ||||||| | |||||||||||||||||||| || |||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
25020622 |
tgagcatagctcagctggtaggacgatgcattattatatgcaggggcctgggttcgaaccccggacaccccacttattcaccttataag |
25020534 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #8
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 188 - 278
Target Start/End: Complemental strand, 12128005 - 12127915
Alignment:
| Q |
188 |
cgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||| ||||||||||||| |||||||||||||||||||||| ||| ||| |||||||||||| |||||||||||||||||||| |
|
|
| T |
12128005 |
cgtgagcatagctcagttggtaggacaatgcattattatatgcaggggtcggaattcgaaccccggacacgccacttattcaccttataag |
12127915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #9
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 185 - 278
Target Start/End: Original strand, 35190759 - 35190852
Alignment:
| Q |
185 |
tcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||| |||||||| |||||||||||| |||||||||||||||||||||| ||| |||| ||||||| ||||||||||||||||||||||||| |
|
|
| T |
35190759 |
tcccatgagcatagctcagttggtagaacaatgcattattatatgcaggggtcggagttcgaaccccgaacaccccacttattcaccttataag |
35190852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #10
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 186 - 281
Target Start/End: Original strand, 9064862 - 9064958
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataagtga |
281 |
Q |
| |
|
|||||||||||| ||||||||| |||| |||||||||||||||||||||| ||||||||| |||||| ||||||||||||||| || ||| |||||| |
|
|
| T |
9064862 |
cccgtgagcatagctcagttggcagggacaatgcattattatatgcaggggccggggttcgaaccccagacaccccacttatttactttaaaagtga |
9064958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #11
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 190 - 278
Target Start/End: Original strand, 26528568 - 26528656
Alignment:
| Q |
190 |
tgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||| || ||||||||| |||||||||||||||||||||| |||||||| |||| |||||||||||||||||||||||||||| |
|
|
| T |
26528568 |
tgagcataacttagttggtagaacaatgcattattatatgcaggggtcggggttcaaacctcggacaccccacttattcaccttataag |
26528656 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #12
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 187 - 278
Target Start/End: Complemental strand, 5288442 - 5288351
Alignment:
| Q |
187 |
ccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||||| ||||||||||||| |||||||||||||||||||||| |||||| | ||| ||||||||| || |||||||||||||||| |
|
|
| T |
5288442 |
ccgtgagcataactcagttggtaggacaatgcattattatatgcaggggtcggggtccgaactccggacacctcaattattcaccttataag |
5288351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #13
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 199 - 278
Target Start/End: Original strand, 9438312 - 9438391
Alignment:
| Q |
199 |
ctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||| ||||||| |||||||||||||||||| |||||||||||||| |
|
|
| T |
9438312 |
ctcagttggtaggacaatgcattattatatgcaggggttggggttcgaaccccggacaccccactcattcaccttataag |
9438391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #14
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 189 - 278
Target Start/End: Complemental strand, 6530300 - 6530210
Alignment:
| Q |
189 |
gtgagcatacctcagttggtagggcaatgca-ttattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||| ||||||||||| ||||||| ||||||||||||||| ||||||||| |||| |||||||||||||||||||||||||||| |
|
|
| T |
6530300 |
gtgagcataaatcagttggtagaacaatgcaattattatatgcaggggccggggttcaaacctcggacaccccacttattcaccttataag |
6530210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #15
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 184 - 270
Target Start/End: Complemental strand, 19642647 - 19642561
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcac |
270 |
Q |
| |
|
|||||||||||||| ||||||||||||| ||||||||||||||||||| | |||||||| |||||| |||||||||||||||||| |
|
|
| T |
19642647 |
gtcccgtgagcatagctcagttggtaggacaatgcattattatatgcatcggtcggggttcgaaccccagacaccccacttattcac |
19642561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #16
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 184 - 278
Target Start/End: Original strand, 30566053 - 30566147
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||||||| ||||||||||||| |||||||||||||||||||| | | ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
30566053 |
gtcccgtgagcataactcagttggtaggacaatgcattattatatgcagaggttgaagtttgaaccccggacaccccacttattcaccttataag |
30566147 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #17
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 183 - 277
Target Start/End: Original strand, 34365729 - 34365823
Alignment:
| Q |
183 |
tgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataa |
277 |
Q |
| |
|
||||||||||||||| |||||||||||| |||||||||||||| ||||||| ||||||||| |||| || |||| ||||||||||| ||||||| |
|
|
| T |
34365729 |
tgtcccgtgagcatagttcagttggtaggacaatgcattattatgtgcaggggccggggttcgaacctcgaacactccacttattcatcttataa |
34365823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #18
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 184 - 278
Target Start/End: Original strand, 34396078 - 34396172
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||||||| |||||||||| | |||||||||||||||||||||| |||| |||| ||| |||||||||| | |||||||||||||||| |
|
|
| T |
34396078 |
gtcccgtgagcatagttcagttggtacgacaatgcattattatatgcaggggccggagttcgaactccggacaccctatttattcaccttataag |
34396172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #19
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 186 - 278
Target Start/End: Original strand, 3448348 - 3448441
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||||| |||| |||| |||| ||||||||| ||||| |||||| ||||||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
3448348 |
cccgtgagcatagctcaattggcagggacaatgcattgttatacgcaggggccggggttcgaaccccggacaccccacttattcatcttataag |
3448441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #20
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 201 - 278
Target Start/End: Original strand, 12101898 - 12101975
Alignment:
| Q |
201 |
cagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||||| |||| ||||||||||||||||| |||| |||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
12101898 |
cagttggtaggacaatacattattatatgcaggggccggcgttcgaaccccggacaccctacttattcaccttataag |
12101975 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #21
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 184 - 281
Target Start/End: Complemental strand, 21507301 - 21507204
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataagtga |
281 |
Q |
| |
|
|||||||||||||| || |||||||||| ||||| |||||||||||||||| ||| ||| ||| ||||||||||||||||||||| |||||||||| |
|
|
| T |
21507301 |
gtcccgtgagcatagcttagttggtaggacaatgtattattatatgcaggggtcggagtttgaactccggacaccccacttattcactttataagtga |
21507204 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #22
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 190 - 281
Target Start/End: Original strand, 29284118 - 29284210
Alignment:
| Q |
190 |
tgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataagtga |
281 |
Q |
| |
|
|||||||| ||||||||||||| ||||| ||||||||||| ||||| |||||||| ||||||||||||||||||||||||| ||| |||||| |
|
|
| T |
29284118 |
tgagcataactcagttggtaggaacaatgtattattatatgtagggatcggggttcgaaccccggacaccccacttattcactttaaaagtga |
29284210 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #23
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 199 - 278
Target Start/End: Complemental strand, 18904768 - 18904689
Alignment:
| Q |
199 |
ctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||||||| ||||||||||||||||| | || ||||||||| ||| | ||||||||||||||||||||||||||| |
|
|
| T |
18904768 |
ctcagttggtaggacaatgcattattatatgtatgggccggggttcgaactctggacaccccacttattcaccttataag |
18904689 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #24
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 186 - 273
Target Start/End: Original strand, 24256913 - 24257000
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
|||||||||||| ||||||||||| | |||||||||||||||||||| ||| ||||| ||||||||| |||||||||||||||||| |
|
|
| T |
24256913 |
cccgtgagcataagtcagttggtagagacatgcattattatatgcaggggccgaggttcgaaccccggataccccacttattcacctt |
24257000 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #25
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 186 - 273
Target Start/End: Complemental strand, 26669757 - 26669670
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
|||||||||||| |||||||||||||| |||||| |||||||| |||| | ||||||| |||||| ||||||||||||||||||||| |
|
|
| T |
26669757 |
cccgtgagcatagctcagttggtagggacatgcataattatatgtaggggctggggttcgaaccccagacaccccacttattcacctt |
26669670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #26
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 183 - 278
Target Start/End: Original strand, 19279447 - 19279538
Alignment:
| Q |
183 |
tgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||||||||| |||||||| ||| | |||||||||||||||||| |||| |||| |||| |||||||||||||||||||||||||||| |
|
|
| T |
19279447 |
tgtcccgtgagcatagctcagttgatag----aagcattattatatgcaggggccggagttcgaacctcggacaccccacttattcaccttataag |
19279538 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #27
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 208 - 278
Target Start/End: Original strand, 22983599 - 22983669
Alignment:
| Q |
208 |
tagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||| ||||| |||||||||||||||| ||||||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
22983599 |
taggacaatgtattattatatgcaggggccggggttcgaaccccggacaccccacttattcatcttataag |
22983669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #28
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 208 - 278
Target Start/End: Complemental strand, 23804809 - 23804739
Alignment:
| Q |
208 |
tagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||| ||||| |||||||||||||||| ||||||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
23804809 |
taggacaatgtattattatatgcaggggccggggttcgaaccccggacaccccacttattcatcttataag |
23804739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #29
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 186 - 272
Target Start/End: Original strand, 34524872 - 34524958
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacct |
272 |
Q |
| |
|
|||||||||||| ||||||||| |||| ||||||| |||||||||||| ||||||||| | ||||| ||||||||||||||||||| |
|
|
| T |
34524872 |
cccgtgagcatagctcagttggcagggacatgcattgttatatgcaggggccggggttcgagccccgaacaccccacttattcacct |
34524958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #30
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 182 - 278
Target Start/End: Original strand, 22501011 - 22501108
Alignment:
| Q |
182 |
atgtcccgtgagcatacctcagttggtagggcaatgcattattatatgca-gggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||| |||||||| ||||||||||||| ||||||||||||||||||| ||| ||||| ||| |||| | |||||||||||||||||||| |||| |
|
|
| T |
22501011 |
atgtcccatgagcatagctcagttggtaggacaatgcattattatatgcaggggtccgggattcgaaccaagaacaccccacttattcaccttgtaag |
22501108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #31
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 184 - 259
Target Start/End: Original strand, 10373590 - 10373665
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccc |
259 |
Q |
| |
|
|||||||||||||| || ||||||||| |||||||||||||||||||||| |||||||| |||||||||||||| |
|
|
| T |
10373590 |
gtcccgtgagcataacttagttggtagaacaatgcattattatatgcaggggtcggggttcgaaccccggacaccc |
10373665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #32
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 199 - 278
Target Start/End: Original strand, 19165361 - 19165439
Alignment:
| Q |
199 |
ctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||||||| |||||||||||||||||||| | ||||||| |||||| |||||||||||||||||||||||||| |
|
|
| T |
19165361 |
ctcagttggtaggacaatgcattattatatgcagaggttggggttcgaacccc-gacaccccacttattcaccttataag |
19165439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #33
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 186 - 267
Target Start/End: Original strand, 2945592 - 2945674
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccacttatt |
267 |
Q |
| |
|
|||||||||||| ||||||||| |||| ||||||||| |||||||||||| |||||||| |||| ||||||||||||||||| |
|
|
| T |
2945592 |
cccgtgagcatagctcagttggcagggacaatgcattgttatatgcaggggtcggggttcaaacctcggacaccccacttatt |
2945674 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #34
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 184 - 278
Target Start/End: Complemental strand, 6025486 - 6025393
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||| |||||| ||||||||||||| ||||||||||||||||||||| |||| ||| ||||||||||| ||||||||||| |||||||| |
|
|
| T |
6025486 |
gtcccgtaagcataactcagttggtaggataatgcattattatatgcaggggtcgggattcgaaccccggaca-tccacttattcatcttataag |
6025393 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #35
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 188 - 278
Target Start/End: Complemental strand, 15289051 - 15288961
Alignment:
| Q |
188 |
cgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||| |||||||||||| || |||||||||||||| |||| | ||||||| ||| || ||||||||||||||||| |||||||| |
|
|
| T |
15289051 |
cgtgagcatagttcagttggtaggacattgcattattatatgtaggggctggggttcgaactccagacaccccacttattcatcttataag |
15288961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #36
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 188 - 278
Target Start/End: Complemental strand, 16251619 - 16251529
Alignment:
| Q |
188 |
cgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||| || |||||||||| ||||||| ||||||||||||| || |||| ||| ||||||||||||||||||||||||||||| |
|
|
| T |
16251619 |
cgtgagcataacttagttggtaggacaatgcacaattatatgcaggggtcgttgttcgaactccggacaccccacttattcaccttataag |
16251529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #37
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 184 - 278
Target Start/End: Original strand, 16801784 - 16801878
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||||||| ||||||||||||| ||| |||||||||||||||| |||||||| || |||||||| ||||||||||||||| |||| |
|
|
| T |
16801784 |
gtcccgtgagcatagctcagttggtaggacaaaacattattatatgcaggagtcggggttcgaattccggacacaccacttattcaccttgtaag |
16801878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #38
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 184 - 278
Target Start/End: Original strand, 19417817 - 19417911
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||| |||||| ||| ||||||||| |||| ||||||||||||||||| |||| ||| || ||| ||||||||||||||||| |||||||| |
|
|
| T |
19417817 |
gtcccgtaagcatagctctgttggtaggataatgtattattatatgcagggatcgggattcgaatcccagacaccccacttattcatcttataag |
19417911 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #39
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 184 - 278
Target Start/End: Original strand, 32057029 - 32057123
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||||||| |||||||| |||| |||||||||||||||||||| | || ||||| |||||| || | |||||||||||| |||||||| |
|
|
| T |
32057029 |
gtcccgtgagcatagctcagttgataggacaatgcattattatatgcagtggtcgaggttcgaaccccagagatcccacttattcatcttataag |
32057123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #40
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 186 - 270
Target Start/End: Original strand, 6143961 - 6144045
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcac |
270 |
Q |
| |
|
|||||||||||| ||||||||| |||| ||||||||||||||||| |||| |||| ||| ||||||||||||||||||||||||| |
|
|
| T |
6143961 |
cccgtgagcatagctcagttggcagggacaatgcattattatatgtaggggtcggg-ttcgaaccccggacaccccacttattcac |
6144045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #41
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 218 - 278
Target Start/End: Original strand, 2970218 - 2970278
Alignment:
| Q |
218 |
cattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||||| |||| ||| ||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
2970218 |
cattattatatgtaggggccgaggttcaaaccccggacaccccacttattcaccttataag |
2970278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #42
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 190 - 278
Target Start/End: Original strand, 15126244 - 15126331
Alignment:
| Q |
190 |
tgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||| ||||||||||||| |||| |||||||||||| |||| ||||||| ||| |||||||||||| |||||||||||||||| |
|
|
| T |
15126244 |
tgagcatagctcagttggtaggacaatacattattatatgtaggg-gaggggttcgaactccggacaccccatttattcaccttataag |
15126331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #43
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 186 - 273
Target Start/End: Original strand, 17305513 - 17305601
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaatgcattattatatgca-gggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
||||||| |||| |||||||||||||| ||||||||||||||||| ||| | ||||||| || || |||||||||||||||||||||| |
|
|
| T |
17305513 |
cccgtgaacataactcagttggtagggacatgcattattatatgcagggggcaggggttcgaatcctggacaccccacttattcacctt |
17305601 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #44
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 186 - 274
Target Start/End: Complemental strand, 22730800 - 22730712
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctta |
274 |
Q |
| |
|
|||||||||||| ||||||||| || | ||||||| |||||||||||||| | |||| |||| |||||||||||||||||||||||| |
|
|
| T |
22730800 |
cccgtgagcataactcagttggcagagacatgcattgttatatgcagggactgaagttcgaacctcggacaccccacttattcacctta |
22730712 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #45
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 183 - 278
Target Start/End: Complemental strand, 16269818 - 16269723
Alignment:
| Q |
183 |
tgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||| |||||||||| ||| ||||||||| || ||||||||||||||||||| | || || ||||||| || |||||||||||||||||||||| |
|
|
| T |
16269818 |
tgtctcgtgagcatagctcggttggtaggacagtgcattattatatgcaggggttgaggatcgaaccccgaacgccccacttattcaccttataag |
16269723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #46
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 190 - 273
Target Start/End: Original strand, 30833018 - 30833101
Alignment:
| Q |
190 |
tgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
|||||||| |||||||| |||| ||||||| |||||||||||| |||||||| ||||||||||||||||||||||| |||| |
|
|
| T |
30833018 |
tgagcatagttcagttggcagggacatgcattgttatatgcaggggtcggggttcgaaccccggacaccccacttattctcctt |
30833101 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #47
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 204 - 278
Target Start/End: Complemental strand, 753392 - 753318
Alignment:
| Q |
204 |
ttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||| |||| |||||||||||| |||| |||||||| ||||| ||||||||||||||||| ||||||||| |
|
|
| T |
753392 |
ttggtaggacaatacattattatatgtaggggtcggggttcgaaccctggacaccccacttattccccttataag |
753318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #48
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 183 - 277
Target Start/End: Complemental strand, 10424635 - 10424542
Alignment:
| Q |
183 |
tgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataa |
277 |
Q |
| |
|
|||| |||||||||| |||||||| ||| ||||||||||||||||| |||| || |||| || ||||||||||||||||||||||||||||| |
|
|
| T |
10424635 |
tgtctcgtgagcataactcagttgataga-caatgcattattatatgtaggggtcgtggtttgaatcccggacaccccacttattcaccttataa |
10424542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #49
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 184 - 278
Target Start/End: Complemental strand, 18244112 - 18244019
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||| ||| |||| ||||||||||||| |||||||||||||||||||| | |||||||| || |||||| |||| ||||||||| |||||||| |
|
|
| T |
18244112 |
gtcccatgaacatagctcagttggtaggacaatgcattattatatgcagaggtcggggttcgaa-cccggataccctacttattcatcttataag |
18244019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #50
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 184 - 278
Target Start/End: Original strand, 18631467 - 18631561
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||| ||||||||| ||||||||||||| |||| |||| |||||||||||| |||| ||| |||||| | ||||||||||||||| ||||||| |
|
|
| T |
18631467 |
gtcctgtgagcatagctcagttggtaggacaatacattgttatatgcaggggtcgggattcgaaccccaaataccccacttattcactttataag |
18631561 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #51
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 192 - 270
Target Start/End: Original strand, 23771036 - 23771114
Alignment:
| Q |
192 |
agcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcac |
270 |
Q |
| |
|
|||||| |||| |||||||| |||||||||||||||||||||| ||||||| ||| |||||||||||| |||||||| |
|
|
| T |
23771036 |
agcatagctcaattggtaggacaatgcattattatatgcaggggaaggggttcgaactccggacaccccatttattcac |
23771114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #52
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 186 - 278
Target Start/End: Complemental strand, 5134533 - 5134440
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||| |||||| ||||||||| || | ||||||||| |||||||||| | ||| ||||| |||| | |||||||||||||||||||||||||| |
|
|
| T |
5134533 |
cccgtaagcatagctcagttggcagagacaatgcattgttatatgcagaggccgcggttcgaacctcagacaccccacttattcaccttataag |
5134440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #53
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 184 - 277
Target Start/End: Original strand, 8233081 - 8233174
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataa |
277 |
Q |
| |
|
|||||||||||||| ||||||||||||| |||| ||||||||||| ||| | | |||||| ||| ||| ||||| ||||||||||||||||| |
|
|
| T |
8233081 |
gtcccgtgagcatagctcagttggtaggacaatacattattatatacagaggtcagggttcgaactccgaacaccttacttattcaccttataa |
8233174 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #54
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 184 - 273
Target Start/End: Original strand, 9422828 - 9422917
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
|||||||||||||| ||||||||| |||| ||||||| |||||| || | | ||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
9422828 |
gtcccgtgagcataactcagttggcagggacatgcattgttatatacaagagctggggttcgaacaccggacaccccacttattcacctt |
9422917 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #55
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 186 - 274
Target Start/End: Original strand, 8175993 - 8176081
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctta |
274 |
Q |
| |
|
|||||||||||| |||||||| || | ||||||| |||||||||||||| || |||| ||| ||| ||||||||||||||||||||| |
|
|
| T |
8175993 |
cccgtgagcatagctcagttgacagagacatgcattgttatatgcagggactggtgttcgaactccgaacaccccacttattcacctta |
8176081 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #56
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 186 - 273
Target Start/End: Original strand, 10455739 - 10455827
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggaca-ccccacttattcacctt |
273 |
Q |
| |
|
|||||||||||| |||||||| ||| ||||||| |||||||||||| ||||||||| ||||||||||| |||||||||||| |||| |
|
|
| T |
10455739 |
cccgtgagcatagttcagttggcaggaacatgcattgttatatgcaggggccggggttcgaaccccggacacccccacttattctcctt |
10455827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #57
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 186 - 277
Target Start/End: Complemental strand, 20568355 - 20568264
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataa |
277 |
Q |
| |
|
||||||||| || ||||||||||| || || ||||| || |||||||||| |||||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
20568355 |
cccgtgagcttagctcagttggtaaggacattgcataat-atatgcaggggtcggggttcgaaccccgaacaccccacttattcaccttataa |
20568264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #58
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 194 - 278
Target Start/End: Complemental strand, 20716482 - 20716398
Alignment:
| Q |
194 |
catacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||| ||||||||||||| ||||||||||||||||| |||| |||| ||| ||| || || |||||||||||||| |||||||| |
|
|
| T |
20716482 |
catagctcagttggtaggacaatgcattattatatgtaggggtcgggattcgaactccagataccccacttattcatcttataag |
20716398 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #59
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 186 - 281
Target Start/End: Complemental strand, 24470490 - 24470394
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataagtga |
281 |
Q |
| |
|
||||| |||||| ||||||||| || | |||||||||||||||| ||||| |||| |||| ||||||||| | ||||||||||||| ||| |||||| |
|
|
| T |
24470490 |
cccgtaagcatagctcagttggcagagacaatgcattattatatacaggggccggagttcgaaccccggaaatcccacttattcactttaaaagtga |
24470394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #60
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 190 - 278
Target Start/End: Complemental strand, 31741557 - 31741469
Alignment:
| Q |
190 |
tgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||| ||||||||||||| ||||||||||||||||| ||||| || |||| || |||||| |||| |||||||||||||||| |
|
|
| T |
31741557 |
tgagcatagctcagttggtaggacaatgcattattatatgtagggattggagttcgaatttcggacatcccatttattcaccttataag |
31741469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #61
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 219 - 278
Target Start/End: Complemental strand, 6270674 - 6270615
Alignment:
| Q |
219 |
attattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||||||||| ||||||||| ||||| | |||||||| |||||||||||||||| |
|
|
| T |
6270674 |
attattatatgcaggggccggggttcgaaccctgaacaccccaattattcaccttataag |
6270615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #62
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 183 - 278
Target Start/End: Original strand, 11982756 - 11982850
Alignment:
| Q |
183 |
tgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||| ||||||| |||||||||||| ||||||||||||||||||||| | ||||| ||||||||||||||||||| || | |||||||| |
|
|
| T |
11982756 |
tgtcccgggagcatagctcagttggtagaataatgcattattatatgcaggggtc-gggtttgaaccccggacaccccacttgtttatcttataag |
11982850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #63
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 187 - 274
Target Start/End: Complemental strand, 17123382 - 17123295
Alignment:
| Q |
187 |
ccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctta |
274 |
Q |
| |
|
||||||||||| |||| ||||| || |||||||| |||||||||| || |||||||||||| | | |||||| |||||||||||||| |
|
|
| T |
17123382 |
ccgtgagcatagctcatttggttggaaaatgcattcttatatgcagagatcggggttctaactctgaacaccctacttattcacctta |
17123295 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #64
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 186 - 269
Target Start/End: Complemental strand, 25064767 - 25064684
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattca |
269 |
Q |
| |
|
|||||||||||| |||||||||| || |||||||||||||||||||| ||||||| |||||| |||||||||||| |||| |
|
|
| T |
25064767 |
cccgtgagcatagttcagttggtatggacatgcattattatatgcaggggttggggttcgaaccccagacaccccacttcttca |
25064684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #65
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 224 - 274
Target Start/End: Complemental strand, 6658603 - 6658553
Alignment:
| Q |
224 |
tatatgcagggaccggggttctaaccccggacaccccacttattcacctta |
274 |
Q |
| |
|
||||||||||| ||||||||| ||||||||||||||||||||||| ||||| |
|
|
| T |
6658603 |
tatatgcaggggccggggttcgaaccccggacaccccacttattctcctta |
6658553 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #66
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 215 - 273
Target Start/End: Complemental strand, 19680317 - 19680259
Alignment:
| Q |
215 |
atgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
||||||| ||||||||||| ||||||||| ||||||||||||||||||||||| |||| |
|
|
| T |
19680317 |
atgcattgttatatgcaggagccggggttcgaaccccggacaccccacttattctcctt |
19680259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #67
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 188 - 278
Target Start/End: Original strand, 22850810 - 22850900
Alignment:
| Q |
188 |
cgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||| ||||||| ||||| ||| ||||||||||||||||| ||||||| || |||| |||||||| |||| ||||||||||| |
|
|
| T |
22850810 |
cgtgagcatagctcagttagtaggaaaatacattattatatgcaggggttggggttcgaagcccgaacaccccatttatacaccttataag |
22850900 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #68
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 188 - 273
Target Start/End: Original strand, 30938390 - 30938475
Alignment:
| Q |
188 |
cgtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
||||||| || |||||||||||||| || ||||| || |||||||||||||||||||| |||||| ||||||| |||||||| |||| |
|
|
| T |
30938390 |
cgtgagcttaactcagttggtagggacattgcataat-atatgcagggaccggggttcgaaccccagacaccctacttattctcctt |
30938475 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #69
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 186 - 281
Target Start/End: Complemental strand, 33629037 - 33628944
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataagtga |
281 |
Q |
| |
|
||||||| |||| ||||||||| |||| ||||||||||||||||| || ||||||| ||||||||||||||||||||||||| ||| |||||| |
|
|
| T |
33629037 |
cccgtgaacatagctcagttggcagggacaatgcattattatatgtc---actggggttcgaaccccggacaccccacttattcactttaaaagtga |
33628944 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #70
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 213 - 278
Target Start/End: Original strand, 9424468 - 9424532
Alignment:
| Q |
213 |
caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||| |||||||||||||| | ||||||||| |||||| |||||| ||||||||||||||||||| |
|
|
| T |
9424468 |
caatgaattattatatgcagaggccggggttcgaacccc-gacacctcacttattcaccttataag |
9424532 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #71
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 183 - 244
Target Start/End: Original strand, 18991478 - 18991539
Alignment:
| Q |
183 |
tgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttc |
244 |
Q |
| |
|
||||||| ||||||| ||||||||||| | ||||||||||||||||| |||| ||||||||| |
|
|
| T |
18991478 |
tgtcccgcgagcatagctcagttggtaagacaatgcattattatatgtaggggccggggttc |
18991539 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #72
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 186 - 264
Target Start/End: Original strand, 27667159 - 27667238
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggc--aatgcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||||||| | |||||||||||||| |||||||| |||||||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
27667159 |
cccgtgagctttgctcagttggtagggacaaatgcatt-ttatatgcaggggccggggttcgaaccccggacaccccactt |
27667238 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #73
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 186 - 274
Target Start/End: Original strand, 34883737 - 34883823
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctta |
274 |
Q |
| |
|
|||||||||||| |||||||||||||| |||| |||||||| ||| || ||||||| || ||||||||||||||||||||||||| |
|
|
| T |
34883737 |
cccgtgagcataactcagttggtagggacatgcgttattatacgcaagggttggggttcaaa--ccggacaccccacttattcacctta |
34883823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #74
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 187 - 270
Target Start/End: Original strand, 3294765 - 3294848
Alignment:
| Q |
187 |
ccgtgagcatacctcagttggtagggcaat-gcattattatatgcagggaccggggttctaaccccggacaccccacttattcac |
270 |
Q |
| |
|
|||||||| || |||||||||||||| || |||| ||||||||||||| |||||||| ||||||||||||||||||| ||||| |
|
|
| T |
3294765 |
ccgtgagcttagctcagttggtagggatattgcat-attatatgcaggggtcggggttcgaaccccggacaccccacttcttcac |
3294848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #75
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 213 - 269
Target Start/End: Original strand, 11636687 - 11636743
Alignment:
| Q |
213 |
caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattca |
269 |
Q |
| |
|
|||||||||||||||||||||| ||| |||| ||||||||||||||||||| |||| |
|
|
| T |
11636687 |
caatgcattattatatgcaggggtcggagttcgaaccccggacaccccactttttca |
11636743 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #76
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 222 - 274
Target Start/End: Original strand, 29169683 - 29169735
Alignment:
| Q |
222 |
attatatgcagggaccggggttctaaccccggacaccccacttattcacctta |
274 |
Q |
| |
|
||||||||||||||| ||||||| ||||||||| |||||||||||||||||| |
|
|
| T |
29169683 |
attatatgcagggactggggttcgaaccccggattccccacttattcacctta |
29169735 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #77
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 186 - 264
Target Start/End: Original strand, 2251838 - 2251916
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaat-gcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||||||| || |||||||||||||| || |||| | ||||||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
2251838 |
cccgtgagcttagctcagttggtagggatattgcat-actatatgcaggggccggggttcgaaccccggacaccccactt |
2251916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #78
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 186 - 273
Target Start/End: Original strand, 6455450 - 6455537
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
||||||| |||| ||||||||||||| || |||||||||||| | || | ||||||| ||| |||||||||| ||||||||||||| |
|
|
| T |
6455450 |
cccgtgaacatagttcagttggtagggacatacattattatatgtatgggctggggttcgaactccggacaccctacttattcacctt |
6455537 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #79
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 190 - 273
Target Start/End: Original strand, 8309165 - 8309248
Alignment:
| Q |
190 |
tgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
|||||||| ||||||||| |||| ||||||| ||||||||| || || | ||| ||||||||||||||||| |||||||||| |
|
|
| T |
8309165 |
tgagcatagctcagttggcagggacatgcattgttatatgcatgggccaagtttcgaaccccggacaccccacctattcacctt |
8309248 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #80
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 186 - 264
Target Start/End: Original strand, 15091448 - 15091526
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaat-gcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||||||| || |||||||||||||| || |||| ||||||||||||| ||||||||| || |||||||||||||||| |
|
|
| T |
15091448 |
cccgtgagcttagctcagttggtagggatattgcat-attatatgcaggggccggggttcgaatcccggacaccccactt |
15091526 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #81
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 187 - 274
Target Start/End: Complemental strand, 30668281 - 30668194
Alignment:
| Q |
187 |
ccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctta |
274 |
Q |
| |
|
||||||||||| ||||||||| | | |||||||||||||||||||| | | |||| |||| || ||||||||||||||||||||| |
|
|
| T |
30668281 |
ccgtgagcataactcagttggcatagacatgcattattatatgcaggggtcagagttcgaaccacgaacaccccacttattcacctta |
30668194 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #82
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 186 - 260
Target Start/End: Original strand, 1968996 - 1969070
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacacccc |
260 |
Q |
| |
|
||||||||| || |||||||||||||| || |||||||||||||| ||||||||| ||||||||||||||| |
|
|
| T |
1968996 |
cccgtgagcttagctcagttggtagggatattacatattatatgcaggggccggggttcgaaccccggacacccc |
1969070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #83
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 182 - 256
Target Start/End: Original strand, 7303785 - 7303859
Alignment:
| Q |
182 |
atgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggaca |
256 |
Q |
| |
|
|||||||||||||||| ||||||||||||| |||| |||||||||||||| | ||| ||| ||||||||||| |
|
|
| T |
7303785 |
atgtcccgtgagcataactcagttggtaggacaatatattattatatgcagaggttgggattcgaaccccggaca |
7303859 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #84
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 189 - 275
Target Start/End: Complemental strand, 9384114 - 9384028
Alignment:
| Q |
189 |
gtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttat |
275 |
Q |
| |
|
|||||| || ||||||||| | || ||||||| ||||| |||||||| ||||||| | ||||||||||| || ||||||||||||| |
|
|
| T |
9384114 |
gtgagcttatctcagttggcaaggatatgcattgttataggcagggactggggttcgagccccggacacctcatttattcaccttat |
9384028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #85
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 185 - 267
Target Start/End: Complemental strand, 14258358 - 14258276
Alignment:
| Q |
185 |
tcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttatt |
267 |
Q |
| |
|
||||||||||||| ||| ||||||||| ||||||| |||||||||||| | |||||| ||||| |||||| ||||||||| |
|
|
| T |
14258358 |
tcccgtgagcatagctccgttggtaggaacatgcattgctatatgcagggatcagggttcgaaccctggacactccacttatt |
14258276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #86
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 228 - 269
Target Start/End: Complemental strand, 4854362 - 4854321
Alignment:
| Q |
228 |
tgcagggaccggggttctaaccccggacaccccacttattca |
269 |
Q |
| |
|
||||||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
4854362 |
tgcaggggccggggttcgaaccccggacaccccacttattca |
4854321 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #87
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 228 - 269
Target Start/End: Complemental strand, 6228316 - 6228275
Alignment:
| Q |
228 |
tgcagggaccggggttctaaccccggacaccccacttattca |
269 |
Q |
| |
|
||||||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
6228316 |
tgcaggggccggggttcgaaccccggacaccccacttattca |
6228275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #88
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 241 - 278
Target Start/End: Complemental strand, 7720546 - 7720509
Alignment:
| Q |
241 |
gttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
7720546 |
gttcgaaccccggacaccccacttattcaccttataag |
7720509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #89
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 223 - 264
Target Start/End: Original strand, 8297664 - 8297705
Alignment:
| Q |
223 |
ttatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
|||||||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
8297664 |
ttatatgcaggggccggggttcgaaccccggacaccccactt |
8297705 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #90
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 181 - 234
Target Start/End: Original strand, 12291162 - 12291215
Alignment:
| Q |
181 |
aatgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcaggg |
234 |
Q |
| |
|
||||||||||||||||| |||||||| ||| ||||||||||||||||| |||| |
|
|
| T |
12291162 |
aatgtcccgtgagcataactcagttgttagaacaatgcattattatatggaggg |
12291215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #91
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 228 - 269
Target Start/End: Complemental strand, 18903423 - 18903382
Alignment:
| Q |
228 |
tgcagggaccggggttctaaccccggacaccccacttattca |
269 |
Q |
| |
|
||||||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
18903423 |
tgcaggggccggggttcgaaccccggacaccccacttattca |
18903382 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #92
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 186 - 264
Target Start/End: Original strand, 18904264 - 18904343
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggc--aatgcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||||||| | |||||||||||||| |||||||| |||||||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
18904264 |
cccgtgagctttgctcagttggtagggacaaatgcatt-ttatatgcaggggtcggggttcgaaccccggacaccccactt |
18904343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #93
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 184 - 273
Target Start/End: Original strand, 24623517 - 24623605
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
||||| ||| |||| ||||||||||||| ||||||||||||||||||| || |||||||| | |||| ||||||||||| ||||||| |
|
|
| T |
24623517 |
gtcccatgaacatagctcagttggtaggacaatgcattattatatgcaagggtcggggttcgagcccc-ttcaccccacttaatcacctt |
24623605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #94
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 213 - 278
Target Start/End: Original strand, 31761178 - 31761243
Alignment:
| Q |
213 |
caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||| |||| |||||||||||| | ||||||| || ||| ||||||| |||||||||||||||||| |
|
|
| T |
31761178 |
caatacatttttatatgcaggggcaggggttcgaatcccagacaccctacttattcaccttataag |
31761243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #95
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 184 - 273
Target Start/End: Original strand, 34521988 - 34522077
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
|||||||||||||| ||||||||||| ||||| |||||||||| ||||| ||| |||| |||| || ||||| ||| |||||||||| |
|
|
| T |
34521988 |
gtcccgtgagcatagtccagttggtaggacaatgaattattatatccaggggacggagttcgaacctcgaacacctcacgtattcacctt |
34522077 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #96
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 185 - 234
Target Start/End: Complemental strand, 34792942 - 34792894
Alignment:
| Q |
185 |
tcccgtgagcatacctcagttggtagggcaatgcattattatatgcaggg |
234 |
Q |
| |
|
||||||||||||| |||||||||| || |||||||||||||||||||||| |
|
|
| T |
34792942 |
tcccgtgagcatagctcagttggt-ggacaatgcattattatatgcaggg |
34792894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #97
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 186 - 274
Target Start/End: Complemental strand, 2955202 - 2955114
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctta |
274 |
Q |
| |
|
|||||||||||| |||| || |||| |||||||||||||||||||| | |||||| ||||| ||| |||||||| |||||||||| |
|
|
| T |
2955202 |
cccgtgagcatagttcagatgccagggacatgcattattatatgcaggggcaggggtttgaaccctggataccccactgattcacctta |
2955114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #98
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 186 - 274
Target Start/End: Original strand, 5544273 - 5544361
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctta |
274 |
Q |
| |
|
||||||| | || |||||||| ||||| ||| ||| |||||||||||| |||||||| |||||| || ||||||||||||| ||||| |
|
|
| T |
5544273 |
cccgtgaacttaactcagttgatagggacatgtattgttatatgcaggggtcggggttcgaaccccagataccccacttattctcctta |
5544361 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #99
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 233 - 273
Target Start/End: Complemental strand, 5641741 - 5641701
Alignment:
| Q |
233 |
ggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
|||||||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
5641741 |
ggaccggggttcgaactccggacaccccacttattcacctt |
5641701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #100
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 186 - 274
Target Start/End: Original strand, 31639138 - 31639226
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctta |
274 |
Q |
| |
|
|||||||||||| |||||||| |||| | ||||| ||||||| |||| |||| |||| ||||| |||||| ||||||||| |||||| |
|
|
| T |
31639138 |
cccgtgagcataactcagttgacagggacacgcattgttatatgtaggggccggagttcgaacccaggacactccacttatttacctta |
31639226 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #101
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 221 - 264
Target Start/End: Original strand, 492937 - 492980
Alignment:
| Q |
221 |
tattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
|||||||||||||| ||||||||| ||||| ||||||||||||| |
|
|
| T |
492937 |
tattatatgcaggggccggggttcgaaccctggacaccccactt |
492980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #102
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 190 - 273
Target Start/End: Original strand, 4844144 - 4844227
Alignment:
| Q |
190 |
tgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
|||| ||| ||||||||| |||| ||||||| |||||||||||| ||||||| |||| | |||||| |||||||||||||| |
|
|
| T |
4844144 |
tgagtataactcagttggcagggacatgcattgttatatgcaggggtcggggtttaaacctcagacacctcacttattcacctt |
4844227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #103
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 202 - 277
Target Start/End: Original strand, 6652223 - 6652297
Alignment:
| Q |
202 |
agttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataa |
277 |
Q |
| |
|
|||||||||| |||||||||||| ||||||||| |||||| ||| || ||||||||| ||||||||||||||| |
|
|
| T |
6652223 |
agttggtaggacaatgcattattttatgcaggg-ttagggttcgaactccagacaccccatttattcaccttataa |
6652297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #104
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 186 - 264
Target Start/End: Original strand, 7545329 - 7545407
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaat-gcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||||||| || |||||||||||||| || |||| ||||||||||||| || |||||| ||||||| ||||||||||| |
|
|
| T |
7545329 |
cccgtgagcttagctcagttggtagggatattgcat-attatatgcaggggccagggttcgaaccccgaacaccccactt |
7545407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #105
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 186 - 264
Target Start/End: Original strand, 9435626 - 9435704
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaat-gcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||||||| || |||||||||||||| || |||| ||||||||||||| | ||||||| |||||||||||| |||||| |
|
|
| T |
9435626 |
cccgtgagcttagctcagttggtagggatattgcat-attatatgcaggggctggggttcgaaccccggacactccactt |
9435704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #106
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 186 - 264
Target Start/End: Original strand, 10934599 - 10934677
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaat-gcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||||||| || |||||||||||||| || |||| |||||||||||| ||||||||| |||||||||||| |||||| |
|
|
| T |
10934599 |
cccgtgagcttagctcagttggtagggatattgcat-attatatgcaggagccggggttcgaaccccggacactccactt |
10934677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #107
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 186 - 273
Target Start/End: Original strand, 11520714 - 11520801
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
|||||||||||| |||| |||| |||| ||||||| |||||||||| | ||||||||| ||| ||| |||| || ||||||||||| |
|
|
| T |
11520714 |
cccgtgagcatatctcaattggcagggatatgcattcttatatgcagtggccggggttcgaactccgaacacatcatttattcacctt |
11520801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #108
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 221 - 264
Target Start/End: Complemental strand, 13158744 - 13158701
Alignment:
| Q |
221 |
tattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
|||||||||||| ||| ||||||| ||||||||||||||||||| |
|
|
| T |
13158744 |
tattatatgcagagactggggttcgaaccccggacaccccactt |
13158701 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #109
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 221 - 264
Target Start/End: Complemental strand, 13163600 - 13163557
Alignment:
| Q |
221 |
tattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
|||||||||||| ||| ||||||| ||||||||||||||||||| |
|
|
| T |
13163600 |
tattatatgcagagactggggttcgaaccccggacaccccactt |
13163557 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #110
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 186 - 264
Target Start/End: Complemental strand, 17441909 - 17441831
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaat-gcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||||||| || |||||||||||||| || |||| |||||||||||| ||||||||| |||||||||||| |||||| |
|
|
| T |
17441909 |
cccgtgagcttagctcagttggtagggatattgcat-attatatgcaggagccggggttcgaaccccggacactccactt |
17441831 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #111
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 215 - 270
Target Start/End: Complemental strand, 17751406 - 17751351
Alignment:
| Q |
215 |
atgcattattatatgcagggaccggggttctaaccccggacaccccacttattcac |
270 |
Q |
| |
|
||||||| ||||||||||| | | ||||| ||||||||||||||||||||||||| |
|
|
| T |
17751406 |
atgcattgttatatgcaggagcagaggttcgaaccccggacaccccacttattcac |
17751351 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #112
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 186 - 264
Target Start/End: Complemental strand, 19953898 - 19953820
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaat-gcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||||||| || |||||||||||||| || |||| |||||||||||| ||||||||| |||||||||||| |||||| |
|
|
| T |
19953898 |
cccgtgagcttagctcagttggtagggatattgcat-attatatgcaggagccggggttcgaaccccggacactccactt |
19953820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #113
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 191 - 273
Target Start/End: Complemental strand, 20150073 - 20149990
Alignment:
| Q |
191 |
gagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaacccc-ggacaccccacttattcacctt |
273 |
Q |
| |
|
||||||| ||||||||| |||| ||| || ||||||| ||||| ||||||| |||||| |||||||||||||||||||||| |
|
|
| T |
20150073 |
gagcatagctcagttgggagggacttgcgttgttatatgtagggattggggttcgaacccctggacaccccacttattcacctt |
20149990 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #114
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 191 - 273
Target Start/End: Original strand, 22182759 - 22182842
Alignment:
| Q |
191 |
gagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaacccc-ggacaccccacttattcacctt |
273 |
Q |
| |
|
||||||| ||||||||| |||| ||| || ||||||| ||||| ||||||| |||||| |||||||||||||||||||||| |
|
|
| T |
22182759 |
gagcatagctcagttgggagggacttgcgttgttatatgtagggattggggttcgaacccctggacaccccacttattcacctt |
22182842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #115
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 186 - 264
Target Start/End: Original strand, 31802053 - 31802131
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaat-gcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||||||| || |||||||||||||| || |||| |||||||||||| ||||||||| |||||||||||| |||||| |
|
|
| T |
31802053 |
cccgtgagcttaactcagttggtagggatattgcat-attatatgcaggagccggggttcgaaccccggacactccactt |
31802131 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #116
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 223 - 273
Target Start/End: Original strand, 7233999 - 7234049
Alignment:
| Q |
223 |
ttatatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
|||||||||||| | |||||| |||| ||||||||||||||||||||||| |
|
|
| T |
7233999 |
ttatatgcaggggctggggtttgaacctcggacaccccacttattcacctt |
7234049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #117
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 184 - 278
Target Start/End: Original strand, 7709880 - 7709973
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||| |||| || |||||||| ||||| |||||||||| ||||| ||| | ||| ||| ||| | ||||| ||||||||||||||||||||| |
|
|
| T |
7709880 |
gtcccgcgagcttagctcagttgatagggtaatgcattatcatatgtaggcatcggaattcgaactc-ggacatcccacttattcaccttataag |
7709973 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #118
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 215 - 273
Target Start/End: Complemental strand, 8253659 - 8253602
Alignment:
| Q |
215 |
atgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
||||||| |||||||||||| | ||||||| ||||| | |||||||||||||||||||| |
|
|
| T |
8253659 |
atgcattgttatatgcaggggctggggttcgaacccag-acaccccacttattcacctt |
8253602 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #119
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 184 - 234
Target Start/End: Complemental strand, 17419797 - 17419747
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcaggg |
234 |
Q |
| |
|
|||||||||||||| ||||||| ||||| |||| |||||||||||||||| |
|
|
| T |
17419797 |
gtcccgtgagcatagctcagttagtaggacaatatattattatatgcaggg |
17419747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #120
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 221 - 270
Target Start/End: Complemental strand, 30341 - 30292
Alignment:
| Q |
221 |
tattatatgcagggaccggggttctaaccccggacaccccacttattcac |
270 |
Q |
| |
|
|||||||||||||| ||||||||| ||||| |||||| |||||| ||||| |
|
|
| T |
30341 |
tattatatgcaggggccggggttcgaaccctggacactccacttcttcac |
30292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #121
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 187 - 268
Target Start/End: Complemental strand, 9051388 - 9051307
Alignment:
| Q |
187 |
ccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattc |
268 |
Q |
| |
|
||||||||||| |||| |||| | || ||||||| ||||||| |||||| |||||| ||||||||||| | ||||||||| |
|
|
| T |
9051388 |
ccgtgagcatagctcaattggcaaggatatgcattgttatatgtagggactagggttcgaaccccggacaactcacttattc |
9051307 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #122
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 221 - 270
Target Start/End: Original strand, 9763467 - 9763516
Alignment:
| Q |
221 |
tattatatgcagggaccggggttctaaccccggacaccccacttattcac |
270 |
Q |
| |
|
||||||||||| || ||||||||| ||||||| | ||||||||||||||| |
|
|
| T |
9763467 |
tattatatgcatgggccggggttccaaccccgaaaaccccacttattcac |
9763516 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #123
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 187 - 264
Target Start/End: Complemental strand, 16268202 - 16268126
Alignment:
| Q |
187 |
ccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
|||||||| || ||| ||||||||| | |||||| |||||||||||| ||||||||| ||||||||| || |||||| |
|
|
| T |
16268202 |
ccgtgagcttaactcggttggtaggatattgcatt-ttatatgcaggggccggggttcgaaccccggatactccactt |
16268126 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #124
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 228 - 269
Target Start/End: Complemental strand, 20415618 - 20415577
Alignment:
| Q |
228 |
tgcagggaccggggttctaaccccggacaccccacttattca |
269 |
Q |
| |
|
||||||| || |||||| |||||||||||||||||||||||| |
|
|
| T |
20415618 |
tgcaggggccagggttcgaaccccggacaccccacttattca |
20415577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #125
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 192 - 273
Target Start/End: Complemental strand, 20858475 - 20858394
Alignment:
| Q |
192 |
agcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
|||||| ||||||||| |||| ||||||| |||||||||||| ||||||| || |||||||||||| ||||| ||||| |
|
|
| T |
20858475 |
agcataactcagttggcagggacatgcattgttatatgcaggggttggggttcgaattccggacaccccatttatttacctt |
20858394 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #126
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 187 - 264
Target Start/End: Original strand, 22997337 - 22997414
Alignment:
| Q |
187 |
ccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
|||||||| || |||||||||||||| || | ||||||||| |||| |||||||| |||||||||||||| |||| |
|
|
| T |
22997337 |
ccgtgagcttagctcagttggtagggatattgaatattatatgtaggggtcggggttcgaaccccggacaccctactt |
22997414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #127
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 187 - 264
Target Start/End: Complemental strand, 23791064 - 23790987
Alignment:
| Q |
187 |
ccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
|||||||| || |||||||||||||| || | ||||||||| |||| |||||||| |||||||||||||| |||| |
|
|
| T |
23791064 |
ccgtgagcttagctcagttggtagggatattgaatattatatgtaggggtcggggttcgaaccccggacaccctactt |
23790987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #128
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 200 - 264
Target Start/End: Original strand, 24319027 - 24319091
Alignment:
| Q |
200 |
tcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||||||||||| || ||||| ||| ||||||||| ||||||||| |||||||||||| |||||| |
|
|
| T |
24319027 |
tcagttggtagggacattgcataatt-tatgcaggggccggggttcgaaccccggacactccactt |
24319091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #129
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 223 - 264
Target Start/End: Original strand, 30704997 - 30705038
Alignment:
| Q |
223 |
ttatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||||| |||| ||||||||| ||||||||||||||||||| |
|
|
| T |
30704997 |
ttatatgtaggggccggggttcgaaccccggacaccccactt |
30705038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #130
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 221 - 270
Target Start/End: Complemental strand, 32813685 - 32813636
Alignment:
| Q |
221 |
tattatatgcagggaccggggttctaaccccggacaccccacttattcac |
270 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||||| || |||||| ||||| |
|
|
| T |
32813685 |
tattatatgcaggggccggggttcgaaccccggatactccacttcttcac |
32813636 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #131
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 246 - 278
Target Start/End: Complemental strand, 3591367 - 3591335
Alignment:
| Q |
246 |
aaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| |
|
|
| T |
3591367 |
aaccccggacaccctacttattcaccttataag |
3591335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #132
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 186 - 274
Target Start/End: Original strand, 6219351 - 6219438
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctta |
274 |
Q |
| |
|
||||||| |||| ||||||||| |||| |||||||||||||| ||| | | || ||| |||||| |||||||||||||||| ||||| |
|
|
| T |
6219351 |
cccgtgaacatagctcagttggcagggacatgcattattatatacagtggtc-ggattcgaaccccagacaccccacttattctcctta |
6219438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #133
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 189 - 277
Target Start/End: Complemental strand, 6297003 - 6296915
Alignment:
| Q |
189 |
gtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataa |
277 |
Q |
| |
|
||||||||| ||| |||| |||| ||||||||||||||||||| | ||| ||| |||| |||||| || ||||||||| ||||||| |
|
|
| T |
6297003 |
gtgagcatagctcggttgataggacaatgcattattatatgcaatggtcggaattcgaacctcggacatcctacttattcatcttataa |
6296915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #134
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 189 - 277
Target Start/End: Complemental strand, 6303813 - 6303725
Alignment:
| Q |
189 |
gtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataa |
277 |
Q |
| |
|
||||||||| ||| |||| |||| ||||||||||||||||||| | ||| ||| |||| |||||| || ||||||||| ||||||| |
|
|
| T |
6303813 |
gtgagcatagctcggttgataggacaatgcattattatatgcaatggtcggaattcgaacctcggacatcctacttattcatcttataa |
6303725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #135
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 186 - 257
Target Start/End: Original strand, 7207844 - 7207915
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaat-gcattattatatgcagggaccggggttctaaccccggacac |
257 |
Q |
| |
|
||||||||| || |||||||||||||| || |||| |||||||||||| ||||||||| |||||||||||| |
|
|
| T |
7207844 |
cccgtgagcttagctcagttggtagggatattgcat-attatatgcaggagccggggttcgaaccccggacac |
7207915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #136
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 224 - 264
Target Start/End: Complemental strand, 7897150 - 7897110
Alignment:
| Q |
224 |
tatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
7897150 |
tatatgcaggggtcggggttcgaaccccggacaccccactt |
7897110 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #137
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 186 - 274
Target Start/End: Complemental strand, 9443561 - 9443473
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctta |
274 |
Q |
| |
|
|||||||||||| |||||||| || || ||||||| ||||||| | || |||| ||| |||| | |||||||||||||||| ||||| |
|
|
| T |
9443561 |
cccgtgagcatagctcagttgatacggacatgcattgttatatgtatgggtcgggattcgaacctcagacaccccacttattctcctta |
9443473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #138
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 194 - 274
Target Start/End: Original strand, 17347260 - 17347339
Alignment:
| Q |
194 |
catacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctta |
274 |
Q |
| |
|
|||| ||||||||| |||| ||||||| ||||||||| || |||| ||| |||| ||||||||||||||||||||||| |
|
|
| T |
17347260 |
cataactcagttggcagggatatgcattgttatatgcatgggtcggg-ttcgaaccttggacaccccacttattcacctta |
17347339 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #139
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 214 - 278
Target Start/End: Original strand, 18247541 - 18247605
Alignment:
| Q |
214 |
aatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||||||||||||||| ||||||| || |||| ||| | |||||||||| |||||||| |
|
|
| T |
18247541 |
aatgcattattatatgcagggttcggggtttgaatcccgaacatctcacttattcatcttataag |
18247605 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #140
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 187 - 270
Target Start/End: Complemental strand, 23610388 - 23610305
Alignment:
| Q |
187 |
ccgtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcac |
270 |
Q |
| |
|
|||||||| || |||||||||||||| || ||||| ||| ||||||||| |||||||| ||| | ||||||||||||| ||||| |
|
|
| T |
23610388 |
ccgtgagcttagctcagttggtagggacattgcataatt-tatgcaggggtcggggttcaaacgctggacaccccacttcttcac |
23610305 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #141
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 230 - 274
Target Start/End: Complemental strand, 25091153 - 25091109
Alignment:
| Q |
230 |
cagggaccggggttctaaccccggacaccccacttattcacctta |
274 |
Q |
| |
|
||||||||||||||| ||| ||||||||||||||||||| |||| |
|
|
| T |
25091153 |
cagggaccggggttcgtacctcggacaccccacttattcatctta |
25091109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #142
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 190 - 234
Target Start/End: Original strand, 26878801 - 26878845
Alignment:
| Q |
190 |
tgagcatacctcagttggtagggcaatgcattattatatgcaggg |
234 |
Q |
| |
|
|||||||| |||||||||| | |||||||||||||||||||||| |
|
|
| T |
26878801 |
tgagcataattcagttggtaagacaatgcattattatatgcaggg |
26878845 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #143
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 189 - 264
Target Start/End: Original strand, 31935102 - 31935177
Alignment:
| Q |
189 |
gtgagcatacctcagttggtagggcaat-gcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
|||||| || |||||||||||||| || ||||| |||||||||||| |||||||| |||||||||||| |||||| |
|
|
| T |
31935102 |
gtgagcttagctcagttggtagggatattgcatt-ttatatgcaggggtcggggttcgaaccccggacactccactt |
31935177 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #144
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 185 - 264
Target Start/End: Complemental strand, 32611625 - 32611546
Alignment:
| Q |
185 |
tcccgtgagcatacctcagttggtagggcaat-gcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
|||| ||||| || |||||||||||||| || |||| |||||||||||| ||||||||| |||||||||||| |||||| |
|
|
| T |
32611625 |
tcccatgagcttagctcagttggtagggatattgcat-attatatgcaggagccggggttcgaaccccggacactccactt |
32611546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #145
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 199 - 264
Target Start/End: Original strand, 32616396 - 32616462
Alignment:
| Q |
199 |
ctcagttggtagggc--aatgcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
|||||||||||||| |||||||| |||||||||||| | ||||||| || |||||||||||||||| |
|
|
| T |
32616396 |
ctcagttggtagggacaaatgcatt-ttatatgcaggggctggggttcgaatcccggacaccccactt |
32616462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #146
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 199 - 264
Target Start/End: Complemental strand, 32621640 - 32621574
Alignment:
| Q |
199 |
ctcagttggtagggc--aatgcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
|||||||||||||| |||||||| |||||||||||| ||||||||| || ||| |||||||||||| |
|
|
| T |
32621640 |
ctcagttggtagggacaaatgcatt-ttatatgcaggggccggggttcgaatcccagacaccccactt |
32621574 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3 (Bit Score: 76; Significance: 4e-35; HSPs: 185)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 76; E-Value: 4e-35
Query Start/End: Original strand, 183 - 278
Target Start/End: Original strand, 33206751 - 33206846
Alignment:
| Q |
183 |
tgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||||||||| ||||||||||||| |||||||||||||||||||||| | ||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
33206751 |
tgtcccgtgagcatagctcagttggtaggacaatgcattattatatgcaggggctggggttcgaaccccggacaccccacttattcaccttataag |
33206846 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #2
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 183 - 278
Target Start/End: Original strand, 35483263 - 35483358
Alignment:
| Q |
183 |
tgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||||||||| ||||||| ||||| |||||||||||||||||||||| |||||||| || |||||||||||||||||||||||||||||| |
|
|
| T |
35483263 |
tgtcccgtgagcatagctcagttagtaggacaatgcattattatatgcaggggtcggggttcgaatcccggacaccccacttattcaccttataag |
35483358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #3
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 183 - 278
Target Start/End: Complemental strand, 42271114 - 42271019
Alignment:
| Q |
183 |
tgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||||||||| ||||||||||||| ||||||||| |||||||||||| ||||||||| ||| |||||||||| |||||||||||||||||| |
|
|
| T |
42271114 |
tgtcccgtgagcatagctcagttggtaggacaatgcattgttatatgcaggggccggggttcgaactccggacaccctacttattcaccttataag |
42271019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #4
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 184 - 278
Target Start/End: Original strand, 49639023 - 49639117
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||||||| ||||||||||||| ||||||||||||||||| |||| ||||||||| ||||||| |||||||||||||||||||| |||| |
|
|
| T |
49639023 |
gtcccgtgagcatagctcagttggtaggacaatgcattattatatgtaggggccggggttcgaaccccgaacaccccacttattcaccttgtaag |
49639117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #5
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 185 - 278
Target Start/End: Original strand, 49146080 - 49146173
Alignment:
| Q |
185 |
tcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||| || ||||||||||||| |||||||||||||||||||||| |||||||| ||||||||||||||||||||||||| ||||||| |
|
|
| T |
49146080 |
tcccgtgagcttaactcagttggtaggacaatgcattattatatgcaggggtcggggttcgaaccccggacaccccacttattcactttataag |
49146173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #6
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 186 - 281
Target Start/End: Original strand, 9624979 - 9625075
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataagtga |
281 |
Q |
| |
|
|||||||||||| ||||||||| |||| |||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||| ||| |||||| |
|
|
| T |
9624979 |
cccgtgagcatagctcagttggcagggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttattcactttaaaagtga |
9625075 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #7
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 186 - 281
Target Start/End: Complemental strand, 27183780 - 27183684
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataagtga |
281 |
Q |
| |
|
|||||||||||| ||||||||| |||| |||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||| ||| |||||| |
|
|
| T |
27183780 |
cccgtgagcatagctcagttggcagggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttattcactttaaaagtga |
27183684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #8
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 182 - 278
Target Start/End: Original strand, 45713473 - 45713569
Alignment:
| Q |
182 |
atgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||||||||| || |||||||||| ||||||||||||||||| |||| |||| |||| ||| ||||||||||||||||||||||||||||| |
|
|
| T |
45713473 |
atgtcccgtgagcataacttagttggtaggacaatgcattattatatgtaggggccggagttcgaactccggacaccccacttattcaccttataag |
45713569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #9
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 183 - 266
Target Start/End: Complemental strand, 24751361 - 24751278
Alignment:
| Q |
183 |
tgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttat |
266 |
Q |
| |
|
||||||||||||||| ||||||| ||||| |||||||||||||||||||||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
24751361 |
tgtcccgtgagcatagctcagttagtaggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttat |
24751278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #10
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 183 - 278
Target Start/End: Complemental strand, 43566897 - 43566802
Alignment:
| Q |
183 |
tgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||| |||| ||||||||||||| |||||||||||||||||||||| |||||||| |||| | |||||||||||||||||||||||||| |
|
|
| T |
43566897 |
tgtcccgtgaacatagctcagttggtaggacaatgcattattatatgcaggggtcggggttcgaacctcagacaccccacttattcaccttataag |
43566802 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #11
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 184 - 278
Target Start/End: Original strand, 14417863 - 14417957
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||| |||||||| |||| |||||||| |||||||||||||||||||||| | || |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
14417863 |
gtcccatgagcatagctcaattggtaggacaatgcattattatatgcaggggctggagttcgaaccccggacaccccacttattcaccttataag |
14417957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #12
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 186 - 281
Target Start/End: Original strand, 14868681 - 14868777
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataagtga |
281 |
Q |
| |
|
|||||||||||| ||||||||| |||| |||||||||||||||||||||| ||||||||| ||||||| ||||||||||||||||| ||| |||||| |
|
|
| T |
14868681 |
cccgtgagcatagctcagttggcagggacaatgcattattatatgcaggggccggggttcgaaccccgaacaccccacttattcactttaaaagtga |
14868777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #13
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 187 - 278
Target Start/End: Complemental strand, 335127 - 335036
Alignment:
| Q |
187 |
ccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||||| || |||||||||| ||||||||||||||||| | ||||||| |||| ||||| ||||||||||||||||||||||||||| |
|
|
| T |
335127 |
ccgtgagcatagcttagttggtaggacaatgcattattatatgtaaggaccggagttcgaaccctggacaccccacttattcaccttataag |
335036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #14
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 179 - 278
Target Start/End: Complemental strand, 20623882 - 20623783
Alignment:
| Q |
179 |
caaatgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||| |||||||||||||| ||||||| ||||| ||||||||||||||||| ||||| | |||||| ||| | ||||||||||||||||||||||||||| |
|
|
| T |
20623882 |
caaaagtcccgtgagcataactcagtttgtaggacaatgcattattatatgtagggatcagggttcgaactcaggacaccccacttattcaccttataag |
20623783 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #15
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 183 - 278
Target Start/End: Complemental strand, 32508895 - 32508800
Alignment:
| Q |
183 |
tgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||||| || |||||||| |||| ||||||||||||||||||||| |||||||| ||||||| ||||||||||||||||||||||||| |
|
|
| T |
32508895 |
tgtcccgtgagcctaactcagttgataggataatgcattattatatgcaggggtcggggttcgaaccccgaacaccccacttattcaccttataag |
32508800 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #16
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 188 - 278
Target Start/End: Original strand, 41121870 - 41121961
Alignment:
| Q |
188 |
cgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccac-ttattcaccttataag |
278 |
Q |
| |
|
|||||||||| ||||||||||||| |||||||||||||||||||| | |||||||| ||||||||||||||||| |||||||||||||||| |
|
|
| T |
41121870 |
cgtgagcataactcagttggtaggacaatgcattattatatgcagaggtcggggttcaaaccccggacaccccactttattcaccttataag |
41121961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #17
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 184 - 278
Target Start/End: Complemental strand, 16278051 - 16277957
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||||||| ||||||||||||| | |||||||||||||||||||| |||| ||| ||| ||||||| ||||||||||||||||||||| |
|
|
| T |
16278051 |
gtcccgtgagcatagctcagttggtaggaccatgcattattatatgcaggggtcgggattcgaactccggacatcccacttattcaccttataag |
16277957 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #18
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 184 - 278
Target Start/End: Complemental strand, 17440065 - 17439971
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||||||| ||| ||||||||| |||||||||||||||||||||| |||| ||| |||| |||| ||||||||||||||||||||||| |
|
|
| T |
17440065 |
gtcccgtgagcatagctcggttggtaggacaatgcattattatatgcaggggccggtgtttgaacctcggataccccacttattcaccttataag |
17439971 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #19
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 184 - 278
Target Start/End: Original strand, 23820624 - 23820718
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||| | || ||||||||||||| |||||||||||||||||||||| |||| |||| |||||| ||||||||||||||||| |||||||| |
|
|
| T |
23820624 |
gtcccgtgaacgtaactcagttggtaggacaatgcattattatatgcaggggccggagttcgaaccccagacaccccacttattcatcttataag |
23820718 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #20
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 185 - 278
Target Start/End: Complemental strand, 13540063 - 13539970
Alignment:
| Q |
185 |
tcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||| ||| ||||||||||||| ||||||||||||||||| |||| ||||||| |||||||||||||||||||||| |||||||||| |
|
|
| T |
13540063 |
tcccgtgagtatagctcagttggtaggacaatgcattattatatgtaggggttggggttcgaaccccggacaccccacttatttaccttataag |
13539970 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #21
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 186 - 278
Target Start/End: Original strand, 47191369 - 47191462
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||||| ||||||||| |||| |||||||||||||||||||||| | || |||| ||||||| ||||||||||||||||||||||||| |
|
|
| T |
47191369 |
cccgtgagcatagctcagttggcagggacaatgcattattatatgcaggggctggagttcgaaccccgaacaccccacttattcaccttataag |
47191462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #22
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 186 - 281
Target Start/End: Original strand, 10959129 - 10959225
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataagtga |
281 |
Q |
| |
|
|||||||||||| ||||||||| |||| |||||||||||||||| |||| ||||||||| ||||||||||||||||||||||||| ||| |||||| |
|
|
| T |
10959129 |
cccgtgagcatagctcagttggcagggacaatgcattattatatataggggccggggttcgaaccccggacaccccacttattcactttaaaagtga |
10959225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #23
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 186 - 281
Target Start/End: Original strand, 52030117 - 52030213
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataagtga |
281 |
Q |
| |
|
|||||||||||| ||||||||| |||| ||||| |||||||||||||||| ||||||||| |||||||||||||| |||||||||| ||| |||||| |
|
|
| T |
52030117 |
cccgtgagcataactcagttggcagggacaatgtattattatatgcaggggccggggttcgaaccccggacaccctacttattcactttaaaagtga |
52030213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #24
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 183 - 274
Target Start/End: Original strand, 50724362 - 50724452
Alignment:
| Q |
183 |
tgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctta |
274 |
Q |
| |
|
||||||||||||||| |||||||||| || |||||||||||||||||||||| ||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
50724362 |
tgtcccgtgagcatagctcagttggt-ggacaatgcattattatatgcaggggttggggttcgaacctcggacaccccacttattcacctta |
50724452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #25
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 183 - 274
Target Start/End: Complemental strand, 50788486 - 50788396
Alignment:
| Q |
183 |
tgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctta |
274 |
Q |
| |
|
||||||||||||||| |||||||||| || |||||||||||||||||||||| ||||||| |||| |||||||||||||||||||||||| |
|
|
| T |
50788486 |
tgtcccgtgagcatagctcagttggt-ggacaatgcattattatatgcaggggttggggttcgaacctcggacaccccacttattcacctta |
50788396 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #26
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 184 - 278
Target Start/End: Complemental strand, 16006606 - 16006512
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||||||| |||||||||||| ||||||||||| ||||||| | |||||||| |||||| |||||||||||||||||||||||||| |
|
|
| T |
16006606 |
gtcccgtgagcataactcagttggtagaacaatgcattataatatgcaagagtcggggttcgaaccccagacaccccacttattcaccttataag |
16006512 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #27
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 192 - 278
Target Start/End: Complemental strand, 34344869 - 34344784
Alignment:
| Q |
192 |
agcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||| |||||||| |||| ||||||||||||||||||||| |||| ||| |||||||||||||||||||||||||||||||||| |
|
|
| T |
34344869 |
agcatagctcagttgataggacaatgcattattatatgcaggtgccggagtt-taaccccggacaccccacttattcaccttataag |
34344784 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #28
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 188 - 278
Target Start/End: Original strand, 38176053 - 38176143
Alignment:
| Q |
188 |
cgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||| |||| ||||||||||||| ||||||| |||||||||| ||| ||||||||| |||||| |||| ||||||||||||||||||||| |
|
|
| T |
38176053 |
cgtgaacatagctcagttggtaggacaatgcaatattatatgctggggccggggttcgaaccccagacagcccacttattcaccttataag |
38176143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #29
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 200 - 278
Target Start/End: Original strand, 53467960 - 53468037
Alignment:
| Q |
200 |
tcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||||| |||||||||||||||||||||| | ||||||| |||| |||||||||||||||||||||||||||| |
|
|
| T |
53467960 |
tcagttggtaggacaatgcattattatatgcaggggc-ggggttcgaacctcggacaccccacttattcaccttataag |
53468037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #30
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 183 - 278
Target Start/End: Complemental strand, 54983810 - 54983711
Alignment:
| Q |
183 |
tgtcccgtgagcatacctcagttggtagggcaatgcattattatat----gcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||||||||| ||||||||||||| ||||||||||||||| |||||| |||||||| |||||||||||||||| |||||||||||||||| |
|
|
| T |
54983810 |
tgtcccgtgagcatagctcagttggtaggataatgcattattatatatatgcaggggtcggggttcgaaccccggacaccccatttattcaccttataag |
54983711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #31
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 186 - 278
Target Start/End: Original strand, 43774181 - 43774274
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||| ||| ||||||||| |||| ||||||||| |||||||||||| |||||||| |||||| |||||||||||||||||||||||||| |
|
|
| T |
43774181 |
cccgtgagtatagctcagttggcagggacaatgcattgttatatgcaggggtcggggttcgaaccccagacaccccacttattcaccttataag |
43774274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #32
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 182 - 278
Target Start/End: Complemental strand, 13616176 - 13616080
Alignment:
| Q |
182 |
atgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||||| |||| ||| ||||||||| ||||||||||||||||| |||| ||| |||| |||| ||||||||||||||||||| |||||||| |
|
|
| T |
13616176 |
atgtcccgtgaacataactcggttggtaggacaatgcattattatatgtaggggtcggagttcgaacctcggacaccccacttattcatcttataag |
13616080 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #33
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 187 - 270
Target Start/End: Complemental strand, 36331824 - 36331740
Alignment:
| Q |
187 |
ccgtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcac |
270 |
Q |
| |
|
||||||||||| |||| |||| |||| |||||||||||||||||||||| |||||||| ||||||||||||||||||||||||| |
|
|
| T |
36331824 |
ccgtgagcatagctcaattggcagggacaatgcattattatatgcaggggtcggggttcgaaccccggacaccccacttattcac |
36331740 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #34
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 199 - 278
Target Start/End: Original strand, 20244144 - 20244223
Alignment:
| Q |
199 |
ctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||| ||||||||| ||||||||| || ||| ||||||||||||||| |
|
|
| T |
20244144 |
ctcagttggtaggacaatgcattattatatgcaggggccggggttcgaaccccggatacttcacgtattcaccttataag |
20244223 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #35
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 186 - 270
Target Start/End: Complemental strand, 7448462 - 7448377
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcac |
270 |
Q |
| |
|
|||||||||||| |||||||| ||||| |||||||||||||||||||||| ||||| ||| |||||| || ||||||||||||||| |
|
|
| T |
7448462 |
cccgtgagcatagctcagttgatagggacaatgcattattatatgcaggggccgggattcgaaccccagataccccacttattcac |
7448377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #36
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 186 - 270
Target Start/End: Complemental strand, 7456604 - 7456519
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcac |
270 |
Q |
| |
|
|||||||||||| |||||||| ||||| |||||||||||||||||||||| ||||| ||| |||||| || ||||||||||||||| |
|
|
| T |
7456604 |
cccgtgagcatagctcagttgatagggacaatgcattattatatgcaggggccgggattcgaaccccagataccccacttattcac |
7456519 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #37
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 178 - 281
Target Start/End: Original strand, 24559376 - 24559481
Alignment:
| Q |
178 |
acaaatgtccc-gtgagcatacctcagttggtagggc-aatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttat |
275 |
Q |
| |
|
||||||||||| ||||||||| ||||||| | |||| ||||||| ||||||||||||| |||||||| ||||||||||||||||||||||||| ||| |
|
|
| T |
24559376 |
acaaatgtccccgtgagcatagctcagttagcagggataatgcataattatatgcaggggtcggggttcgaaccccggacaccccacttattcactttaa |
24559475 |
T |
 |
| Q |
276 |
aagtga |
281 |
Q |
| |
|
|||||| |
|
|
| T |
24559476 |
aagtga |
24559481 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #38
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 180 - 278
Target Start/End: Original strand, 34503206 - 34503306
Alignment:
| Q |
180 |
aaatgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttc--taaccccggacaccccacttattcaccttataa |
277 |
Q |
| |
|
||||||| |||||||||| ||||||||||||| ||||||||||||||||||||| ||||||||| ||||| ||||| |||| | ||||||||||||| |
|
|
| T |
34503206 |
aaatgtctcgtgagcatagctcagttggtaggacaatgcattattatatgcaggagccggggttcgagaaccctggacatcccattcattcaccttataa |
34503305 |
T |
 |
| Q |
278 |
g |
278 |
Q |
| |
|
| |
|
|
| T |
34503306 |
g |
34503306 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #39
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 214 - 278
Target Start/End: Original strand, 2732688 - 2732752
Alignment:
| Q |
214 |
aatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||||| ||||||||| | ||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
2732688 |
aatgcattattgtatgcaggggcaggggttcgaaccccggacaccccacttattcaccttataag |
2732752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #40
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 186 - 281
Target Start/End: Original strand, 36476355 - 36476451
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataagtga |
281 |
Q |
| |
|
|||||||||||| |||| |||| | || |||||||||||||||||||||| |||| |||| ||||||| ||||||||||||||||| ||| |||||| |
|
|
| T |
36476355 |
cccgtgagcataactcaattggcacggacaatgcattattatatgcaggggccggagttcgaaccccgaacaccccacttattcactttaaaagtga |
36476451 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #41
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 194 - 278
Target Start/End: Complemental strand, 36727552 - 36727469
Alignment:
| Q |
194 |
catacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||| ||||||||||||| ||||||||||||||||||| || | ||||||| |||| ||||||||||||||||||| |||||||| |
|
|
| T |
36727552 |
catagctcagttggtaggacaatgcattattatatgcaaggtc-ggggttcgaacctcggacaccccacttattcatcttataag |
36727469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #42
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 186 - 273
Target Start/End: Original strand, 24130556 - 24130643
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
|||||||||||| ||||||||| |||| || |||| |||||||||||| ||||||| |||||||||||||||||||||||||||| |
|
|
| T |
24130556 |
cccgtgagcataactcagttggcagggacatacattgttatatgcaggggacggggtttgaaccccggacaccccacttattcacctt |
24130643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #43
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 223 - 278
Target Start/End: Original strand, 24537861 - 24537916
Alignment:
| Q |
223 |
ttatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||||| ||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
24537861 |
ttatatgcaggggccggggttcgaaccccggacaccccacttattcaccttataag |
24537916 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #44
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 184 - 275
Target Start/End: Original strand, 27066605 - 27066696
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttat |
275 |
Q |
| |
|
||||||| |||||| ||||||||||| | || ||||||||||||||||| | |||||| |||||||||||||||||||||||||||||| |
|
|
| T |
27066605 |
gtcccgtaagcatagctcagttggtaagataaatcattattatatgcaggggtcagggttcgaaccccggacaccccacttattcaccttat |
27066696 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #45
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 223 - 278
Target Start/End: Complemental strand, 46328985 - 46328930
Alignment:
| Q |
223 |
ttatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||||| ||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
46328985 |
ttatatgcaggggccggggttcgaaccccggacaccccacttattcaccttataag |
46328930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #46
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 187 - 278
Target Start/End: Original strand, 48173284 - 48173375
Alignment:
| Q |
187 |
ccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||||| ||||||||||| | ||||||||||||||||| | || || |||| ||||||||||||| ||||||||||||||||||| |
|
|
| T |
48173284 |
ccgtgagcatagctcagttggtaagacaatgcattattatatgtatgggttggagttcgaaccccggacacctcacttattcaccttataag |
48173375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #47
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 187 - 273
Target Start/End: Original strand, 3973300 - 3973386
Alignment:
| Q |
187 |
ccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
||||||||||| |||||||||||||| ||||||| |||||||||||| ||| | || |||||||||||||||| ||||||||||| |
|
|
| T |
3973300 |
ccgtgagcatagctcagttggtagggacatgcattgttatatgcaggggccgcgatttgaaccccggacaccccatttattcacctt |
3973386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #48
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 187 - 273
Target Start/End: Complemental strand, 3996576 - 3996490
Alignment:
| Q |
187 |
ccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
||||||||||| |||||||||||||| ||||||| |||||||||||| ||| | || |||||||||||||||| ||||||||||| |
|
|
| T |
3996576 |
ccgtgagcatagctcagttggtagggacatgcattgttatatgcaggggccgcgatttgaaccccggacaccccatttattcacctt |
3996490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #49
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 184 - 278
Target Start/End: Complemental strand, 13874933 - 13874840
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||| |||| |||||||||| || |||||||||||||||||||||| |||||||| || ||| |||| |||| |||||||||||||||| |
|
|
| T |
13874933 |
gtcccgtgaacatagctcagttggt-ggacaatgcattattatatgcaggggtcggggttcaaatcccagacatcccatttattcaccttataag |
13874840 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #50
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 184 - 278
Target Start/End: Complemental strand, 21420289 - 21420195
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||| || ||||||||||||| |||||||||||||||||||| | || ||||| || || |||||||||||||||| |||||||||| |
|
|
| T |
21420289 |
gtcccgtgagtttagctcagttggtaggacaatgcattattatatgcagcggtcgaggttcgaatcctggacaccccacttatttaccttataag |
21420195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #51
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 185 - 271
Target Start/End: Original strand, 32665277 - 32665363
Alignment:
| Q |
185 |
tcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacc |
271 |
Q |
| |
|
|||||| |||||| ||||||| ||||| |||||||||||||||||| || |||||||| ||| |||||||||||||||||||||| |
|
|
| T |
32665277 |
tcccgttagcatagctcagttagtaggataatgcattattatatgcaagggtcggggttcaaactccggacaccccacttattcacc |
32665363 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #52
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 188 - 278
Target Start/End: Original strand, 40786279 - 40786369
Alignment:
| Q |
188 |
cgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||| ||||||||||||| ||||||||||||||||||| || |||||||| |||| | ||| |||||||||||| | ||||||| |
|
|
| T |
40786279 |
cgtgagcatagctcagttggtaggacaatgcattattatatgcatgggtcggggttcgaacctcagacgccccacttattctctttataag |
40786369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #53
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 185 - 270
Target Start/End: Original strand, 3955301 - 3955389
Alignment:
| Q |
185 |
tcccgtgagcatacctcagttggtaggg-caatgcattattatatgcaggga--ccggggttctaaccccggacaccccacttattcac |
270 |
Q |
| |
|
||||||||||||| |||| ||| |||| |||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
3955301 |
tcccgtgagcatagctcaattgacagggacaatgcattattatatgcaggggggccggggttcgaaccccggacaccccacttattcac |
3955389 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #54
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 189 - 273
Target Start/End: Complemental strand, 31108855 - 31108771
Alignment:
| Q |
189 |
gtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
||||||||| ||||||||| |||| |||||| ||||||||||||| | ||||||| ||||| ||||||||||||||||||||| |
|
|
| T |
31108855 |
gtgagcataactcagttggcagggacatgcataattatatgcaggggctggggttcgaacccgagacaccccacttattcacctt |
31108771 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #55
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 189 - 262
Target Start/End: Original strand, 3784069 - 3784143
Alignment:
| Q |
189 |
gtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccac |
262 |
Q |
| |
|
||||||||| ||||||||| |||| |||||||||||||||| ||||| |||||||| ||||||||||||||||| |
|
|
| T |
3784069 |
gtgagcatagctcagttggcagggacaatgcattattatatacaggggtcggggttcgaaccccggacaccccac |
3784143 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #56
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 187 - 273
Target Start/End: Original strand, 28951864 - 28951950
Alignment:
| Q |
187 |
ccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
||||||||||| ||||||||| || |||||||||||||||||||| | |||||| ||||||| |||||||||||||||||||| |
|
|
| T |
28951864 |
ccgtgagcataactcagttggcagatacatgcattattatatgcaggggtcagggttcgaaccccgaacaccccacttattcacctt |
28951950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #57
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 213 - 278
Target Start/End: Original strand, 362967 - 363032
Alignment:
| Q |
213 |
caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||||||||||||||| ||| |||| ||||||||| ||||||||||||||| ||||||| |
|
|
| T |
362967 |
caatgcattattatatgcaggggtcggagttcgaaccccggataccccacttattcactttataag |
363032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #58
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 184 - 277
Target Start/End: Original strand, 2564916 - 2565009
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataa |
277 |
Q |
| |
|
|||||||||||||| |||||||||||| || ||||||||||||||||||| ||| |||| || | |||||||||||||||| || |||||| |
|
|
| T |
2564916 |
gtcccgtgagcataactcagttggtagaacagtgcattattatatgcaggggccgtggtttgaattctggacaccccacttatttactttataa |
2565009 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #59
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 189 - 278
Target Start/End: Complemental strand, 32876211 - 32876122
Alignment:
| Q |
189 |
gtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||| ||||||||||||| |||||||||||||||||||||| || |||| |||| |||||| || | |||||||| ||||||| |
|
|
| T |
32876211 |
gtgagcatatctcagttggtaggacaatgcattattatatgcaggggtcgaagttcaaacctcggacatcctatttattcacattataag |
32876122 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #60
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 194 - 263
Target Start/End: Complemental strand, 35849369 - 35849300
Alignment:
| Q |
194 |
catacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccact |
263 |
Q |
| |
|
|||| ||||||||||||| |||||||||||||||||||||||| | ||||| |||| | ||||||||||| |
|
|
| T |
35849369 |
catagctcagttggtaggacaatgcattattatatgcagggactgtggttcgaacctcagacaccccact |
35849300 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #61
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 201 - 278
Target Start/End: Original strand, 39492833 - 39492910
Alignment:
| Q |
201 |
cagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||| |||| ||||||||||||||||||| || | ||||||| |||||| ||||||||||||||| || ||||||| |
|
|
| T |
39492833 |
cagttgttaggacaatgcattattatatgcatgggctggggttcgaaccccagacaccccacttatttacgttataag |
39492910 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #62
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 188 - 273
Target Start/End: Original strand, 40160734 - 40160819
Alignment:
| Q |
188 |
cgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
|||||||||| |||| |||| |||| ||||||| |||||||| ||| | |||||| |||||||||||||||||||||||||||| |
|
|
| T |
40160734 |
cgtgagcatagctcaattggcagggacatgcattgttatatgccggggctggggtttgaaccccggacaccccacttattcacctt |
40160819 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #63
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 182 - 278
Target Start/End: Complemental strand, 42832158 - 42832068
Alignment:
| Q |
182 |
atgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||||| |||| | ||||||||||| ||||||||||||||||| |||||||| |||||||||||| ||| |||||||||||||||| |
|
|
| T |
42832158 |
atgtcccgtgatcatagcccagttggtaggataatgcattattatatgc------cggggttcgaaccccggacactccatttattcaccttataag |
42832068 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #64
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 185 - 278
Target Start/End: Original strand, 53870830 - 53870923
Alignment:
| Q |
185 |
tcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||||||| ||| ||||||| | |||||||||| ||||||||||| ||| || ||| ||||||||||||||||||||| ||||||| |
|
|
| T |
53870830 |
tcccgtgagcatagctcggttggtaagataatgcattatgatatgcagggatcggaattagaactccggacaccccacttattcacattataag |
53870923 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #65
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 189 - 273
Target Start/End: Complemental strand, 4010113 - 4010029
Alignment:
| Q |
189 |
gtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
||||||||| |||||||||||||| ||||||| |||||||||||| ||| ||| ||||||| |||||||| ||||||||||| |
|
|
| T |
4010113 |
gtgagcatagctcagttggtagggacatgcattgttatatgcaggggccgcagtttgaaccccgaacaccccatttattcacctt |
4010029 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #66
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 214 - 278
Target Start/End: Original strand, 31698558 - 31698622
Alignment:
| Q |
214 |
aatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||||||||||||| ||||||||| |||| || |||||||||||||||| |||||||| |
|
|
| T |
31698558 |
aatgcattattatatgcaggagccggggttcgaacctcgaacaccccacttattcatcttataag |
31698622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #67
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 199 - 275
Target Start/End: Original strand, 54295216 - 54295292
Alignment:
| Q |
199 |
ctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttat |
275 |
Q |
| |
|
||||||||||||| ||||||||| |||||| |||| ||||||||| |||| ||||||| |||||||||||| |||| |
|
|
| T |
54295216 |
ctcagttggtaggataatgcattaatatatgtaggggccggggttcgaacctcggacactccacttattcactttat |
54295292 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #68
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 199 - 278
Target Start/End: Complemental strand, 9167356 - 9167277
Alignment:
| Q |
199 |
ctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||| ||||||| ||||| |||||||||||||||| |||||||| ||| ||||||||||| |||||||||||||||| |
|
|
| T |
9167356 |
ctcaattggtagaacaatgtattattatatgcaggggtcggggttcgaacttcggacaccccagttattcaccttataag |
9167277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #69
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 186 - 261
Target Start/End: Complemental strand, 16874288 - 16874213
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacacccca |
261 |
Q |
| |
|
|||||||||||| ||||||||| |||| ||||||| |||||||||||| ||| ||||| |||| ||||||||||| |
|
|
| T |
16874288 |
cccgtgagcatagctcagttggcagggacatgcattgttatatgcaggggccgaggttcgaaccgcggacacccca |
16874213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #70
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 186 - 273
Target Start/End: Original strand, 19137616 - 19137703
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
|||||||||||| ||||||||| ||| ||||||| |||||||||||| ||| ||||| |||||| ||||||||| |||||| |||| |
|
|
| T |
19137616 |
cccgtgagcatagctcagttggcaggaacatgcattgttatatgcaggggccgaggttcgaaccccagacaccccatttattctcctt |
19137703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #71
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 183 - 258
Target Start/End: Original strand, 19540335 - 19540410
Alignment:
| Q |
183 |
tgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacacc |
258 |
Q |
| |
|
|||||| |||||||| ||||||||||||| |||| |||||||||||||||| | ||||||| ||||||| ||||| |
|
|
| T |
19540335 |
tgtcccatgagcatagctcagttggtaggacaatacattattatatgcaggagctggggttcgaaccccgaacacc |
19540410 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #72
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 184 - 279
Target Start/End: Original strand, 35140714 - 35140809
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataagt |
279 |
Q |
| |
|
|||||||||| || |||| ||||| | |||||||||||||||||||| | ||| ||| | || ||||||||||||| ||||||||||||||||| |
|
|
| T |
35140714 |
gtcccgtgagattagctcaattggttgaacaatgcattattatatgcagtggccgaggtgcgaatcccggacaccccaattattcaccttataagt |
35140809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #73
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 226 - 273
Target Start/End: Original strand, 49429497 - 49429544
Alignment:
| Q |
226 |
tatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
|||||||||||| |||||| |||||||||||||||||||||||||||| |
|
|
| T |
49429497 |
tatgcagggaccagggttcgaaccccggacaccccacttattcacctt |
49429544 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #74
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 231 - 278
Target Start/End: Complemental strand, 50144659 - 50144612
Alignment:
| Q |
231 |
agggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||||||| |||||||||||| |||||||||||||||||||| |
|
|
| T |
50144659 |
agggaccggggttcgaaccccggacactccacttattcaccttataag |
50144612 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #75
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 207 - 277
Target Start/End: Original strand, 15498224 - 15498294
Alignment:
| Q |
207 |
gtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataa |
277 |
Q |
| |
|
||||| ||||||||||||||||| |||| |||| |||| ||||||||||| ||||||||||| ||||||| |
|
|
| T |
15498224 |
gtaggacaatgcattattatatgtaggggccggagttcgaaccccggacattccacttattcatcttataa |
15498294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #76
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 219 - 273
Target Start/End: Complemental strand, 21249055 - 21249001
Alignment:
| Q |
219 |
attattatatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
|||||||||||||||| ||||||||| ||||| | |||||||||||||||||||| |
|
|
| T |
21249055 |
attattatatgcaggggccggggttcgaaccctgaacaccccacttattcacctt |
21249001 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #77
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 188 - 270
Target Start/End: Complemental strand, 24160624 - 24160542
Alignment:
| Q |
188 |
cgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcac |
270 |
Q |
| |
|
|||||||||| ||||||||| || | ||||| | |||||||||||| |||||||| |||||||||||| |||||||||||| |
|
|
| T |
24160624 |
cgtgagcataactcagttggcagagacatgcactgttatatgcaggggtcggggttcgaaccccggacactccacttattcac |
24160542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #78
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 184 - 278
Target Start/End: Complemental strand, 28206637 - 28206543
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||| ||| ||| ||||||||||||| ||| |||||||||||||| || || |||| ||||| ||||| ||||||||||||||||||||| |
|
|
| T |
28206637 |
gtcccgcgagtatagctcagttggtaggacaagacattattatatgcacgggtcgaggtttgaaccctggacatcccacttattcaccttataag |
28206543 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #79
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 186 - 279
Target Start/End: Complemental strand, 28226286 - 28226192
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataagt |
279 |
Q |
| |
|
||||||| |||| ||||||||| ||| |||||||||||||||||||||| ||||||| || |||| ||||||||||||||||| ||| |||| |
|
|
| T |
28226286 |
cccgtgaacataactcagttggcaggaacaatgcattattatatgcaggggttggggttcgaatcccgaacaccccacttattcactttaaaagt |
28226192 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #80
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 199 - 269
Target Start/End: Complemental strand, 34407175 - 34407105
Alignment:
| Q |
199 |
ctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattca |
269 |
Q |
| |
|
||||||||| |||| |||||||||||||||||||| ||||||| |||||| ||||||||||||||||| |
|
|
| T |
34407175 |
ctcagttggcagggacatgcattattatatgcaggggttggggttcgaaccccagacaccccacttattca |
34407105 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #81
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 185 - 274
Target Start/End: Original strand, 38507644 - 38507731
Alignment:
| Q |
185 |
tcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctta |
274 |
Q |
| |
|
||||||||||||| ||||||||| |||| |||||||||||||| |||| |||||||| ||||| ||||||||||||||||||||| |
|
|
| T |
38507644 |
tcccgtgagcatagctcagttggcagggacatgcattattatat--aggggtcggggttcaaaccctaaacaccccacttattcacctta |
38507731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #82
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 200 - 278
Target Start/End: Original strand, 49019194 - 49019272
Alignment:
| Q |
200 |
tcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||| | ||||||||||||||||| |||| |||||||| || | | |||||| ||||||||||||||||||| |
|
|
| T |
49019194 |
tcagttggtaagacaatgcattattatatgtaggggtcggggttcgaatctcagacaccgcacttattcaccttataag |
49019272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #83
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 181 - 278
Target Start/End: Complemental strand, 4072836 - 4072739
Alignment:
| Q |
181 |
aatgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||| |||| ||| ||||||||| ||| ||||| ||||||||||||||| ||| |||| ||| |||||||||| ||||||||||||||||| |
|
|
| T |
4072836 |
aatgtcctgtgaatatatctcagttgggaggacaatgtattattatatgcaggagtcggagttcgaacttcggacacccctcttattcaccttataag |
4072739 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #84
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 189 - 278
Target Start/End: Complemental strand, 17269413 - 17269325
Alignment:
| Q |
189 |
gtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||| ||||||||||||| || |||||||||||||| ||||| | |||||| || || |||||| |||||||||||||| |||| |
|
|
| T |
17269413 |
gtgagcataactcagttggtaggacattgcattattatatgtagggatcagggttcgaattcc-gacacctcacttattcaccttctaag |
17269325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #85
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 217 - 270
Target Start/End: Complemental strand, 22432978 - 22432925
Alignment:
| Q |
217 |
gcattattatatgcagggaccggggttctaaccccggacaccccacttattcac |
270 |
Q |
| |
|
||||| |||||||||||| ||||||||| |||||||||||| |||||||||||| |
|
|
| T |
22432978 |
gcattgttatatgcaggggccggggttcaaaccccggacactccacttattcac |
22432925 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #86
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 186 - 264
Target Start/End: Complemental strand, 27330003 - 27329924
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggc--aatgcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||||||| | |||||||||||||| |||||||| |||||||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
27330003 |
cccgtgagctttgctcagttggtagggacaaatgcatt-ttatatgcaggggccggggttcgaaccccggacaccccactt |
27329924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #87
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 213 - 278
Target Start/End: Original strand, 27739797 - 27739862
Alignment:
| Q |
213 |
caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||||||||||| |||| |||| ||| |||||||||||||||| |||||||| ||||||| |
|
|
| T |
27739797 |
caatgcattattatatgtaggggccggagtttgaaccccggacaccccatttattcacattataag |
27739862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #88
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 183 - 240
Target Start/End: Original strand, 33072284 - 33072341
Alignment:
| Q |
183 |
tgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggg |
240 |
Q |
| |
|
|||| |||||||||| |||||||| |||| |||||||||||||||||||||| ||||| |
|
|
| T |
33072284 |
tgtctcgtgagcataactcagttgataggacaatgcattattatatgcaggggccggg |
33072341 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #89
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 186 - 264
Target Start/End: Complemental strand, 44625296 - 44625217
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggc--aatgcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||||||| | |||||||||||||| |||||||| |||||||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
44625296 |
cccgtgagctttgctcagttggtagggacaaatgcatt-ttatatgcaggggccggggttcgaaccccggacaccccactt |
44625217 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #90
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 189 - 278
Target Start/End: Original strand, 47427725 - 47427812
Alignment:
| Q |
189 |
gtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||| ||| ||||||||| |||||||||||||||||||| | || |||||| || ||||| |||| |||||||||||||||||| |
|
|
| T |
47427725 |
gtgagcatagctccgttggtaggacaatgcattattatatgcagaggcc-gggttc-aaatccggataccctacttattcaccttataag |
47427812 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #91
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 186 - 264
Target Start/End: Original strand, 51879094 - 51879173
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggc--aatgcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||||||| | |||||||||||||| |||||||| |||||||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
51879094 |
cccgtgagctttgctcagttggtagggacaaatgcatt-ttatatgcaggggccggggttcgaaccccggacaccccactt |
51879173 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #92
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 189 - 269
Target Start/End: Complemental strand, 4478463 - 4478383
Alignment:
| Q |
189 |
gtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattca |
269 |
Q |
| |
|
||||||||| ||||||| ||| | |||||||||||||||||||| |||||||| || |||||||| |||||||||||| |
|
|
| T |
4478463 |
gtgagcatagctcagttagtatgaacatgcattattatatgcaggggtcggggttcgaatcccggacatcccacttattca |
4478383 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #93
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 190 - 278
Target Start/End: Complemental strand, 38682352 - 38682264
Alignment:
| Q |
190 |
tgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||| ||| |||||||| |||| ||||||||||||||||| |||| ||| || ||||||||||| |||||||| |||||||| |
|
|
| T |
38682352 |
tgagcatagttcatttggtaggacaatacattattatatgcaggggtcgggattcgaatcccggacaccctccttattcatcttataag |
38682264 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #94
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 185 - 264
Target Start/End: Original strand, 39719934 - 39720013
Alignment:
| Q |
185 |
tcccgtgagcatacctcagttggtagggcaat-gcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||||||| || |||||||||||||| || |||| ||||||||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
39719934 |
tcccgtgagtttagctcagttggtagggatattgcat-attatatgcaggggccggggttcgaaccccggacaccccactt |
39720013 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #95
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 186 - 274
Target Start/End: Complemental strand, 40956785 - 40956697
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctta |
274 |
Q |
| |
|
|||||||||||| |||||||||||||| | ||||||||||| || || |||| |||| ||||||||||||| || ||||||| |||| |
|
|
| T |
40956785 |
cccgtgagcataactcagttggtagggacaaacattattatatacaagggccggagttcgaaccccggacacctcatttattcagctta |
40956697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #96
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 183 - 278
Target Start/End: Original strand, 53472618 - 53472714
Alignment:
| Q |
183 |
tgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcag-ggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||| |||||||| || | |||||||| ||||||||||||||||| || ||| ||||||| ||| || ||||||||||||||||| ||||||| |
|
|
| T |
53472618 |
tgtcccatgagcatagcttaattggtaggacaatgcattattatatggagaggatcggggtttgaactccaaacaccccacttattcactttataag |
53472714 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #97
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 189 - 236
Target Start/End: Original strand, 19117458 - 19117505
Alignment:
| Q |
189 |
gtgagcatacctcagttggtagggcaatgcattattatatgcagggac |
236 |
Q |
| |
|
||||||||| ||||||||||||| |||| ||||||||||||||||||| |
|
|
| T |
19117458 |
gtgagcatagctcagttggtaggacaatacattattatatgcagggac |
19117505 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #98
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 186 - 264
Target Start/End: Original strand, 24303390 - 24303468
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||||||| || ||||||||| |||| || ||||| ||| ||||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
24303390 |
cccgtgagcttagctcagttggcagggacattgcataatt-tatgcaggggccggggttcgaaccccggacaccccactt |
24303468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #99
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 215 - 274
Target Start/End: Complemental strand, 31902274 - 31902215
Alignment:
| Q |
215 |
atgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctta |
274 |
Q |
| |
|
||||||| ||||||| |||| |||||||| ||| ||||||||||||||||||||||||| |
|
|
| T |
31902274 |
atgcatttttatatgtaggggtcggggttcgaactccggacaccccacttattcacctta |
31902215 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #100
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 186 - 264
Target Start/End: Complemental strand, 32256624 - 32256546
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaat-gcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||||||| || |||||||||||||| || |||| |||||||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
32256624 |
cccgtgagcttagctcagttggtagggatattgcatg-ttatatgcaggggccggggttcgaaccccggacaccccactt |
32256546 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #101
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 221 - 264
Target Start/End: Complemental strand, 34102646 - 34102603
Alignment:
| Q |
221 |
tattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
34102646 |
tattatatgcaggggccggggttcgaaccccggacaccccactt |
34102603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #102
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 186 - 264
Target Start/End: Complemental strand, 37488530 - 37488452
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaat-gcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||||||| || |||||||||||||| || ||||| |||||||||||| ||||||||| |||||||||||| |||||| |
|
|
| T |
37488530 |
cccgtgagcttagctcagttggtagggatatcgcatt-ttatatgcaggggccggggttcgaaccccggacactccactt |
37488452 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #103
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 221 - 264
Target Start/End: Complemental strand, 41936442 - 41936399
Alignment:
| Q |
221 |
tattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
41936442 |
tattatatgcaggggccggggttcgaaccccggacaccccactt |
41936399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #104
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 186 - 273
Target Start/End: Original strand, 42935417 - 42935504
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
|||||||||||| ||||||||||| || ||| ||| |||||| ||||||||| ||| |||||| |||||||||||||||| |||| |
|
|
| T |
42935417 |
cccgtgagcatagctcagttggtaaggatatgtattgttatattcagggaccgaagtttgaaccccagacaccccacttattctcctt |
42935504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #105
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 199 - 278
Target Start/End: Complemental strand, 47062151 - 47062073
Alignment:
| Q |
199 |
ctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||||||| ||||||||||||||||| | || ||| |||| |||||||||||||||| ||||| || ||||||| |
|
|
| T |
47062151 |
ctcagttggtaggacaatgcattattatatg-atgggtcggagttcgaaccccggacaccccatttattaactttataag |
47062073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #106
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 186 - 264
Target Start/End: Original strand, 50234124 - 50234202
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaat-gcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||||||| ||||||||||||||||| || |||| |||||||||||| ||||||||| |||||||||||| |||||| |
|
|
| T |
50234124 |
cccgtgagcttacctcagttggtagggatattgcat-attatatgcaggagccggggttcgaaccccggacactccactt |
50234202 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #107
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 186 - 264
Target Start/End: Original strand, 53163594 - 53163672
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaat-gcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||||||| || |||||||||||||| || |||| |||||||| |||| ||||||||| ||||||||||||||||||| |
|
|
| T |
53163594 |
cccgtgagcttagctcagttggtagggatattgcat-attatatgtaggggccggggttcgaaccccggacaccccactt |
53163672 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #108
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 221 - 264
Target Start/End: Complemental strand, 53432772 - 53432729
Alignment:
| Q |
221 |
tattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
53432772 |
tattatatgcaggggccggggttcgaaccccggacaccccactt |
53432729 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #109
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 188 - 278
Target Start/End: Original strand, 8475414 - 8475504
Alignment:
| Q |
188 |
cgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||| ||||||||||||| ||||||||||| |||||||| | ||||||| || ||| |||| || ||||||||| ||||||| |
|
|
| T |
8475414 |
cgtgagcatagctcagttggtaggacaatgcattatgatatgcagaggtcggggtttgaatcccagacatccaacttattcagtttataag |
8475504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #110
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 223 - 273
Target Start/End: Original strand, 27394541 - 27394591
Alignment:
| Q |
223 |
ttatatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
|||||||||||| | |||||| |||||||||||||||||||||||||||| |
|
|
| T |
27394541 |
ttatatgcaggggctggggtttgaaccccggacaccccacttattcacctt |
27394591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #111
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 187 - 233
Target Start/End: Original strand, 29507215 - 29507261
Alignment:
| Q |
187 |
ccgtgagcatacctcagttggtagggcaatgcattattatatgcagg |
233 |
Q |
| |
|
|||||||| || ||||||||||||| ||||||||||||||||||||| |
|
|
| T |
29507215 |
ccgtgagcttaactcagttggtaggacaatgcattattatatgcagg |
29507261 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #112
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 204 - 278
Target Start/End: Original strand, 37059462 - 37059536
Alignment:
| Q |
204 |
ttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||| ||||||||||||||||||||| | || |||| || |||| ||||| |||||||||| |||||||| |
|
|
| T |
37059462 |
ttggtaggataatgcattattatatgcaggggctggagttcgaatcccgaacacctcacttattcatcttataag |
37059536 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #113
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 185 - 264
Target Start/End: Complemental strand, 49029015 - 49028935
Alignment:
| Q |
185 |
tcccgtgagcatacctcagttggtagggc--aatgcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
|||||||||| | |||||||||||||| |||||||| |||||||||||||||||||||| ||||||| |||| |||||| |
|
|
| T |
49029015 |
tcccgtgagctttgctcagttggtagggacaaatgcatt-ttatatgcagggaccggggttcgaaccccgaacactccactt |
49028935 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #114
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 189 - 266
Target Start/End: Complemental strand, 3993802 - 3993725
Alignment:
| Q |
189 |
gtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttat |
266 |
Q |
| |
|
||||||||| |||||||| |||| ||||||| |||||||||||| ||| |||| |||||||||||||||| |||| |
|
|
| T |
3993802 |
gtgagcatagctcagttgagagggacatgcattgttatatgcaggggccgcggtttgaaccccggacaccccatttat |
3993725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #115
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 221 - 278
Target Start/End: Complemental strand, 14271990 - 14271933
Alignment:
| Q |
221 |
tattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||||||| |||| |||| ||||||||||||| || ||||||| |||||||| |
|
|
| T |
14271990 |
tattatatgcaggggccggagttcgaaccccggacacctcatttattcatcttataag |
14271933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #116
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 213 - 274
Target Start/End: Complemental strand, 18020321 - 18020260
Alignment:
| Q |
213 |
caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctta |
274 |
Q |
| |
|
|||||||||||| ||||||||| ||| |||| |||||| ||||||||||||||| |||||| |
|
|
| T |
18020321 |
caatgcattattttatgcaggggtcggtgttcaaaccccagacaccccacttatttacctta |
18020260 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #117
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 188 - 264
Target Start/End: Complemental strand, 19222654 - 19222578
Alignment:
| Q |
188 |
cgtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||||| || ||||||||| |||| || ||||| ||| ||||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
19222654 |
cgtgagcttaactcagttggcagggacattgcataatt-tatgcaggggccggggttcgaaccccggacaccccactt |
19222578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #118
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 185 - 270
Target Start/End: Complemental strand, 21142832 - 21142747
Alignment:
| Q |
185 |
tcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcac |
270 |
Q |
| |
|
|||||| |||||| || ||||||||||| |||||| |||||||||||| ||||||||| | | ||||| |||| |||||||||| |
|
|
| T |
21142832 |
tcccgtaagcatagcttagttggtagggacgtgcattgttatatgcaggggccggggttcgagcaccggaaaccctacttattcac |
21142747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #119
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 228 - 269
Target Start/End: Complemental strand, 29645883 - 29645842
Alignment:
| Q |
228 |
tgcagggaccggggttctaaccccggacaccccacttattca |
269 |
Q |
| |
|
||||||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
29645883 |
tgcaggggccggggttcgaaccccggacaccccacttattca |
29645842 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #120
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 189 - 278
Target Start/End: Complemental strand, 30198973 - 30198885
Alignment:
| Q |
189 |
gtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||| |||| |||||||| |||||||| |||||||||||| || | |||| || ||||| || ||||||||||||| ||||||| |
|
|
| T |
30198973 |
gtgagcataactcaattggtaggataatgcattgttatatgcaggggcctgagttcgaa-cccggtcaacccacttattcactttataag |
30198885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #121
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 213 - 278
Target Start/End: Original strand, 37279651 - 37279716
Alignment:
| Q |
213 |
caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||| ||||||||||||||| | ||||||| ||| || |||||||||||||||||||||||||| |
|
|
| T |
37279651 |
caatacattattatatgcagaggttggggttcgaactccagacaccccacttattcaccttataag |
37279716 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #122
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 186 - 231
Target Start/End: Complemental strand, 41430879 - 41430834
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaatgcattattatatgca |
231 |
Q |
| |
|
|||||||||||| |||||||||||||| ||||||||||||||||| |
|
|
| T |
41430879 |
cccgtgagcataactcagttggtagggatatgcattattatatgca |
41430834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #123
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 190 - 270
Target Start/End: Original strand, 45118644 - 45118724
Alignment:
| Q |
190 |
tgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcac |
270 |
Q |
| |
|
||||| || |||||||||||||| || |||||||| |||||||||| ||||||||| ||||| ||| |||||||||||||| |
|
|
| T |
45118644 |
tgagcttagctcagttggtagggacattgcattat-atatgcaggggccggggttcgaacccgggattccccacttattcac |
45118724 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #124
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 184 - 229
Target Start/End: Original strand, 50720417 - 50720462
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatg |
229 |
Q |
| |
|
|||||||||||||| |||||||||||| ||||||||||||||||| |
|
|
| T |
50720417 |
gtcccgtgagcatagttcagttggtaggacaatgcattattatatg |
50720462 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #125
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 184 - 229
Target Start/End: Complemental strand, 50792431 - 50792386
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatg |
229 |
Q |
| |
|
|||||||||||||| |||||||||||| ||||||||||||||||| |
|
|
| T |
50792431 |
gtcccgtgagcatagttcagttggtaggacaatgcattattatatg |
50792386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #126
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 185 - 273
Target Start/End: Original strand, 2903704 - 2903792
Alignment:
| Q |
185 |
tcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
|||||||| |||| || |||||| | || || |||| |||||||||||| | ||||||| ||||||||| |||| ||||||||||||| |
|
|
| T |
2903704 |
tcccgtgaacatagcttagttggcatggacatacattgttatatgcaggggctggggttcaaaccccggatacccaacttattcacctt |
2903792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #127
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 185 - 264
Target Start/End: Original strand, 4138999 - 4139078
Alignment:
| Q |
185 |
tcccgtgagcatacctcagttggtagggcaat-gcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
|||||||||| || |||||||||||||| || |||| |||||||||||| ||||||||| |||||||||||| |||||| |
|
|
| T |
4138999 |
tcccgtgagcttagctcagttggtagggatattgcat-attatatgcaggagccggggttcgaaccccggacactccactt |
4139078 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #128
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 186 - 274
Target Start/End: Complemental strand, 6951888 - 6951801
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctta |
274 |
Q |
| |
|
|||||||||||| |||||||| |||| |||||||||||||||||||| | || || |||| |||||||| ||||||||||||||| |
|
|
| T |
6951888 |
cccgtgagcataactcagttgacagggacatgcattattatatgcaggggtc-ggatttgaacctcggacaccgcacttattcacctta |
6951801 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #129
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 188 - 272
Target Start/End: Original strand, 7020773 - 7020857
Alignment:
| Q |
188 |
cgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacct |
272 |
Q |
| |
|
|||||||||| |||||||| || | |||||||||||||| || || |||||||| |||||||| ||||| |||||||||||| |
|
|
| T |
7020773 |
cgtgagcatagatcagttggcagagacatgcattattatatacatgggtcggggttcgaaccccggtcacccaacttattcacct |
7020857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #130
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 226 - 278
Target Start/End: Original strand, 8175797 - 8175849
Alignment:
| Q |
226 |
tatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||| || ||||| ||| ||| ||||||||||||||||||||||||| |
|
|
| T |
8175797 |
tatgcagggatcgaggttcgaactccgaacaccccacttattcaccttataag |
8175849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #131
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 199 - 271
Target Start/End: Original strand, 28962974 - 28963046
Alignment:
| Q |
199 |
ctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacc |
271 |
Q |
| |
|
||||||||||||| |||||||| |||||| ||||| |||||||| || |||| ||| |||||||||||||| |
|
|
| T |
28962974 |
ctcagttggtaggataatgcattgttatatacaggggtcggggttcgaatcccgaacatcccacttattcacc |
28963046 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #132
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 189 - 273
Target Start/End: Original strand, 32080055 - 32080139
Alignment:
| Q |
189 |
gtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
|||| |||| ||||||| | |||| ||| ||||||||||| | || |||||||| ||||||| |||||||||||||||||||| |
|
|
| T |
32080055 |
gtgaacatagctcagtttgcaggggcatgaattattatatgtatgggtcggggttcgaaccccgaacaccccacttattcacctt |
32080139 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #133
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 189 - 264
Target Start/End: Original strand, 32776214 - 32776289
Alignment:
| Q |
189 |
gtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
|||||| || |||||||||||||| || ||||| ||| ||||||||| ||||||||| ||||||||||||| ||||| |
|
|
| T |
32776214 |
gtgagcttagctcagttggtagggacattgcataatt-tatgcaggggccggggttcgaaccccggacacctcactt |
32776289 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #134
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 190 - 270
Target Start/End: Original strand, 36842163 - 36842243
Alignment:
| Q |
190 |
tgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcac |
270 |
Q |
| |
|
|||||||| |||||||| ||||| ||||||| ||| || ||||| |||||||| ||||||| ||| ||||||||||||| |
|
|
| T |
36842163 |
tgagcataactcagttgatagggatatgcatttttaaattcaggggtcggggttcgaaccccgtacatcccacttattcac |
36842243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #135
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 221 - 273
Target Start/End: Original strand, 45431659 - 45431711
Alignment:
| Q |
221 |
tattatatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
|||| ||||||||| | |||||| |||||||||||||||||||||||||||| |
|
|
| T |
45431659 |
tattttatgcaggggtcagggttcgaaccccggacaccccacttattcacctt |
45431711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #136
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 185 - 264
Target Start/End: Original strand, 47098731 - 47098810
Alignment:
| Q |
185 |
tcccgtgagcatacctcagttggtagggcaat-gcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
|||||||||| || |||||||||||||| || |||| ||||||||||||| ||||||||| |||||| ||||| |||||| |
|
|
| T |
47098731 |
tcccgtgagcttagctcagttggtagggatattgcat-attatatgcaggggccggggttcgaaccccagacactccactt |
47098810 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #137
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 226 - 273
Target Start/End: Original strand, 166825 - 166872
Alignment:
| Q |
226 |
tatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
||||||||| ||||||||| |||||| |||||| |||||||||||||| |
|
|
| T |
166825 |
tatgcaggggccggggttcgaaccccagacacctcacttattcacctt |
166872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #138
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 186 - 273
Target Start/End: Complemental strand, 11668367 - 11668280
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
|||||||||||| |||||||| | | ||| ||| |||||||||| ||||||||| |||| ||||||||||||||||||||||| |
|
|
| T |
11668367 |
cccgtgagcataactcagttgaaaagaacatgtattgttatatgcagaagccggggttcgaaccacggacaccccacttattcacctt |
11668280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #139
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 223 - 270
Target Start/End: Original strand, 19879238 - 19879285
Alignment:
| Q |
223 |
ttatatgcagggaccggggttctaaccccggacaccccacttattcac |
270 |
Q |
| |
|
|||||||||||| ||||||||| ||||||| ||||||||||| ||||| |
|
|
| T |
19879238 |
ttatatgcaggggccggggttcgaaccccgaacaccccacttcttcac |
19879285 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #140
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 186 - 264
Target Start/End: Complemental strand, 31327788 - 31327710
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaat-gcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||||||| || |||||||||||||| || |||| |||||||||||| ||||||||| |||||||||||| |||||| |
|
|
| T |
31327788 |
cccgtgagcttagctcagttggtagggatattgcat-attatatgcaggagccggggttcgaaccccggacactccactt |
31327710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #141
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 34136757 - 34136808
Alignment:
| Q |
183 |
tgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcaggg |
234 |
Q |
| |
|
||||| ||||||||| |||||||||||| ||||||||||||||||| |||| |
|
|
| T |
34136757 |
tgtcctgtgagcatagctcagttggtagaacaatgcattattatatgtaggg |
34136808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #142
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 186 - 264
Target Start/End: Complemental strand, 37800681 - 37800603
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaat-gcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||||||| || |||||||||||||| || |||| |||||||||||| ||||||||| |||||||||||| |||||| |
|
|
| T |
37800681 |
cccgtgagcttagctcagttggtagggatattgcat-attatatgcaggagccggggttcgaaccccggacactccactt |
37800603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #143
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 186 - 264
Target Start/End: Complemental strand, 40933901 - 40933823
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaat-gcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||||||| || |||||||||||||| || |||| |||||||||||| ||||||||| |||||||||||| |||||| |
|
|
| T |
40933901 |
cccgtgagcttagctcagttggtagggatattgcat-attatatgcaggagccggggttcgaaccccggacactccactt |
40933823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #144
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 186 - 264
Target Start/End: Complemental strand, 48739814 - 48739736
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaat-gcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||||||| || |||||||||||||| || ||||| |||||||||||| | ||||||| |||||| |||||||||||| |
|
|
| T |
48739814 |
cccgtgagcttagctcagttggtagggatattgcatt-ttatatgcaggggctggggttcgaaccccagacaccccactt |
48739736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #145
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 186 - 264
Target Start/End: Original strand, 49447138 - 49447216
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaat-gcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
|||||||| ||| |||||||||||||| || |||| |||||||||||| ||||||||| |||||||||||| |||||| |
|
|
| T |
49447138 |
cccgtgagtatagctcagttggtagggatattgcat-attatatgcaggagccggggttcgaaccccggacactccactt |
49447216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #146
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 186 - 264
Target Start/End: Complemental strand, 50496884 - 50496806
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaat-gcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||||||| || |||||||||||||| || |||| |||||||||||| ||||||||| |||||||||||| |||||| |
|
|
| T |
50496884 |
cccgtgagcttagctcagttggtagggatattgcat-attatatgcaggagccggggttcgaaccccggacactccactt |
50496806 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #147
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 186 - 264
Target Start/End: Complemental strand, 52974123 - 52974045
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaat-gcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||||||| || |||||||||||||| || |||| |||||||||||| ||||||||| |||||||||||| |||||| |
|
|
| T |
52974123 |
cccgtgagcttaactcagttggtagggatattgcat-attatatgcaggagccggggttcgaaccccggacactccactt |
52974045 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #148
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 186 - 264
Target Start/End: Complemental strand, 53347360 - 53347282
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaat-gcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||||||| || |||||||||||||| || |||| ||||||||||||||| ||||||| |||||| ||||| |||||| |
|
|
| T |
53347360 |
cccgtgagcttagctcagttggtagggatattgcat-attatatgcagggactggggttcgaaccccagacactccactt |
53347282 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #149
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 192 - 270
Target Start/End: Original strand, 23237365 - 23237443
Alignment:
| Q |
192 |
agcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcac |
270 |
Q |
| |
|
|||||| ||||||||| |||| ||||||||||||||| |||| ||| |||| ||| ||||||| ||||| ||||||| |
|
|
| T |
23237365 |
agcatagctcagttggcagggacatgcattattatatgtaggggtcggagttcgaactccggacatcccacatattcac |
23237443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #150
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 228 - 269
Target Start/End: Original strand, 25165479 - 25165521
Alignment:
| Q |
228 |
tgcagggaccggggttctaaccccggaca-ccccacttattca |
269 |
Q |
| |
|
||||||||||||||||| ||||||||||| ||||||||||||| |
|
|
| T |
25165479 |
tgcagggaccggggttcgaaccccggacacccccacttattca |
25165521 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #151
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 240 - 278
Target Start/End: Original strand, 30157053 - 30157091
Alignment:
| Q |
240 |
ggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
30157053 |
ggttcgaaccccggacacccaacttattcaccttataag |
30157091 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #152
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 186 - 264
Target Start/End: Complemental strand, 31529028 - 31528950
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||||||| || |||||||||||||| || | ||||||||||||| |||||||| |||||||||||| |||||| |
|
|
| T |
31529028 |
cccgtgagcttagctcagttggtagggatattgaatattatatgcaggagtcggggttcgaaccccggacactccactt |
31528950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #153
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 216 - 278
Target Start/End: Original strand, 35477758 - 35477820
Alignment:
| Q |
216 |
tgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||||||| ||| ||| |||| ||| ||||||||||||||||||||||||||||| |
|
|
| T |
35477758 |
tgcattattatatttaggtgtcggagttcgaactccggacaccccacttattcaccttataag |
35477820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #154
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 199 - 264
Target Start/End: Original strand, 38949687 - 38949752
Alignment:
| Q |
199 |
ctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
|||||||||||||| || ||||| ||| ||||||||| ||||||||| ||||||| ||||||||||| |
|
|
| T |
38949687 |
ctcagttggtagggacattgcataatt-tatgcaggggccggggttcgaaccccgaacaccccactt |
38949752 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #155
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 215 - 273
Target Start/End: Complemental strand, 42665994 - 42665936
Alignment:
| Q |
215 |
atgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
||||||| ||| |||||||| ||| |||| ||| |||||||||||||||||||||||| |
|
|
| T |
42665994 |
atgcattgttaaatgcaggggtcggagttcgaactccggacaccccacttattcacctt |
42665936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #156
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 184 - 281
Target Start/End: Original strand, 44976568 - 44976665
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataagtga |
281 |
Q |
| |
|
|||||||||||||| |||||||| |||| ||||||||||||||||| | | ||| |||| |||| |||||| ||||||||||||| ||| |||||| |
|
|
| T |
44976568 |
gtcccgtgagcataactcagttgacagggacaatgcattattatatgtaagagtcggagttcgaacctcggaca-cccacttattcactttaaaagtga |
44976665 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #157
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 221 - 270
Target Start/End: Complemental strand, 5641649 - 5641600
Alignment:
| Q |
221 |
tattatatgcagggaccggggttctaaccccggacaccccacttattcac |
270 |
Q |
| |
|
|||||||||||||| ||||||||| |||| |||||||| ||||| ||||| |
|
|
| T |
5641649 |
tattatatgcaggggccggggttcgaacctcggacacctcacttcttcac |
5641600 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #158
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 184 - 233
Target Start/End: Original strand, 8958358 - 8958407
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagg |
233 |
Q |
| |
|
|||| ||||||||| ||||||||||||| ||||||||| |||||||||| |
|
|
| T |
8958358 |
gtcctgtgagcatagctcagttggtaggataatgcattactatatgcagg |
8958407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #159
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 190 - 264
Target Start/End: Original strand, 10828473 - 10828548
Alignment:
| Q |
190 |
tgagcatacctcagttggtagggc--aatgcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||| || |||||||||||||| ||||||| ||||||||||| |||||| |||| |||||| |||||||||||| |
|
|
| T |
10828473 |
tgagcttagctcagttggtagggacaaatgcat-attatatgcagagaccggagttcgaaccccagacaccccactt |
10828548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #160
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 188 - 264
Target Start/End: Complemental strand, 17602744 - 17602668
Alignment:
| Q |
188 |
cgtgagcatacctcagttggtagggcaat-gcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||||| || |||||||||||||| || |||| |||||||| |||| ||| ||||| ||||||||||||||||||| |
|
|
| T |
17602744 |
cgtgagcttagctcagttggtagggatattgcat-attatatgtaggggccgaggttcgaaccccggacaccccactt |
17602668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #161
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 186 - 264
Target Start/End: Complemental strand, 25884059 - 25883980
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggc--aatgcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||||||| || || ||||||||||| ||||||| || |||||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
25884059 |
cccgtgagcttagcttagttggtagggacaaatgcataat-atatgcaggggtcggggttcgaaccccggacaccccactt |
25883980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #162
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 228 - 269
Target Start/End: Original strand, 29226365 - 29226406
Alignment:
| Q |
228 |
tgcagggaccggggttctaaccccggacaccccacttattca |
269 |
Q |
| |
|
||||||| ||||||||| ||||||| |||||||||||||||| |
|
|
| T |
29226365 |
tgcaggggccggggttcgaaccccgtacaccccacttattca |
29226406 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #163
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 188 - 264
Target Start/End: Complemental strand, 30779635 - 30779559
Alignment:
| Q |
188 |
cgtgagcatacctcagttggtagggcaat-gcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||||| || |||||||||||||| || |||| ||||||||||||| |||||||| ||||| ||||||||||||| |
|
|
| T |
30779635 |
cgtgagcttagctcagttggtagggatattgcat-attatatgcaggggtcggggttcgaaccctggacaccccactt |
30779559 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #164
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 185 - 274
Target Start/End: Complemental strand, 31917966 - 31917877
Alignment:
| Q |
185 |
tcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctta |
274 |
Q |
| |
|
|||| |||||||| ||||||| ||||| ||||||| ||||||| || | |||| ||| ||| |||||||||||||||||||||||| |
|
|
| T |
31917966 |
tcccatgagcatagctcagtttgtaggaacatgcattgttatatgtagaggtcgggcttcgaacttcggacaccccacttattcacctta |
31917877 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #165
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 213 - 278
Target Start/End: Original strand, 40692239 - 40692304
Alignment:
| Q |
213 |
caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||||||||||||||| ||| ||||| || ||| || | | |||||||||| |||||||| |
|
|
| T |
40692239 |
caatgcattattatatgcaggggccgaggttcgaatcccagaaatctcacttattcatcttataag |
40692304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #166
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 224 - 269
Target Start/End: Original strand, 50381749 - 50381794
Alignment:
| Q |
224 |
tatatgcagggaccggggttctaaccccggacaccccacttattca |
269 |
Q |
| |
|
||||||||||| |||||||| || ||||||||||||||||||||| |
|
|
| T |
50381749 |
tatatgcaggggtcggggttcgaatcccggacaccccacttattca |
50381794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #167
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 223 - 264
Target Start/End: Original strand, 50659627 - 50659668
Alignment:
| Q |
223 |
ttatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
|||||||||||| ||||||||| |||||||||||| |||||| |
|
|
| T |
50659627 |
ttatatgcaggggccggggttcgaaccccggacactccactt |
50659668 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #168
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 202 - 270
Target Start/End: Original strand, 54079779 - 54079848
Alignment:
| Q |
202 |
agttggtagggcaatgcattattatatgca-gggaccggggttctaaccccggacaccccacttattcac |
270 |
Q |
| |
|
|||||||||| ||||||||||||||||| | ||| | |||||| ||||||||||| || |||||||||| |
|
|
| T |
54079779 |
agttggtaggacaatgcattattatatgtatggggcatgggttcaaaccccggacatcctacttattcac |
54079848 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #169
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 185 - 264
Target Start/End: Complemental strand, 9176657 - 9176578
Alignment:
| Q |
185 |
tcccgtgagcatacctcagttggtagggcaat-gcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
|||||||||| || |||||||||||||| || |||| |||||||||| | ||||||||| |||||||||||| |||||| |
|
|
| T |
9176657 |
tcccgtgagcttagctcagttggtagggatattgcat-attatatgcaagagccggggttcgaaccccggacactccactt |
9176578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #170
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 12236596 - 12236644
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaatgcattattatatgcaggg |
234 |
Q |
| |
|
||||||||| || ||||||||| |||| |||||||||||||||||||| |
|
|
| T |
12236596 |
cccgtgagcgtagctcagttggcagggacatgcattattatatgcaggg |
12236644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #171
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 193 - 269
Target Start/End: Original strand, 16999932 - 17000008
Alignment:
| Q |
193 |
gcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattca |
269 |
Q |
| |
|
||||| ||| ||||| |||| ||||||||||||||| |||| |||| |||| ||| || |||||||||| |||||| |
|
|
| T |
16999932 |
gcataactctgttggcagggacatgcattattatatgtaggggccggagttcgaactccagacaccccacatattca |
17000008 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #172
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 225 - 273
Target Start/End: Original strand, 17262255 - 17262303
Alignment:
| Q |
225 |
atatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
|||||||||| | | ||||| || ||||||||||||||||||||||||| |
|
|
| T |
17262255 |
atatgcaggggctgaggttcgaatcccggacaccccacttattcacctt |
17262303 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #173
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 246 - 278
Target Start/End: Complemental strand, 18201515 - 18201483
Alignment:
| Q |
246 |
aaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||||||| |||||||||||||||||| |
|
|
| T |
18201515 |
aaccccggacaccctacttattcaccttataag |
18201483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #174
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 226 - 270
Target Start/End: Complemental strand, 24136810 - 24136766
Alignment:
| Q |
226 |
tatgcagggaccggggttctaaccccggacaccccacttattcac |
270 |
Q |
| |
|
||||||||| || ||| || ||||||||||||||||||||||||| |
|
|
| T |
24136810 |
tatgcaggggccagggatcgaaccccggacaccccacttattcac |
24136766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #175
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 186 - 274
Target Start/End: Original strand, 26583098 - 26583186
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctta |
274 |
Q |
| |
|
||||||| |||| |||| ||| |||| |||||||||||||||||||| |||||||| ||| |||||||| || ||||||| |||| |
|
|
| T |
26583098 |
cccgtgatcataactcaattgacagggacatgcattattatatgcaggggtcggggttcgaactacggacacctcaattattcatctta |
26583186 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #176
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 221 - 261
Target Start/End: Original strand, 29098727 - 29098767
Alignment:
| Q |
221 |
tattatatgcagggaccggggttctaaccccggacacccca |
261 |
Q |
| |
|
|||||||||||||| |||||||| |||||||||||||||| |
|
|
| T |
29098727 |
tattatatgcaggggtcggggttcgaaccccggacacccca |
29098767 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #177
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 185 - 264
Target Start/End: Complemental strand, 29373520 - 29373441
Alignment:
| Q |
185 |
tcccgtgagcatacctcagttggtagggcaat-gcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
|||||||||| || ||||||||||| || || |||| ||||||||||||| ||||||||| |||| | |||||||||||| |
|
|
| T |
29373520 |
tcccgtgagcttaactcagttggtaaggatattgcat-attatatgcaggggccggggttcgaacctcagacaccccactt |
29373441 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #178
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 221 - 261
Target Start/End: Original strand, 32144619 - 32144659
Alignment:
| Q |
221 |
tattatatgcagggaccggggttctaaccccggacacccca |
261 |
Q |
| |
|
||||||||||||| ||||||||| |||||||||||||||| |
|
|
| T |
32144619 |
tattatatgcaggagccggggttcgaaccccggacacccca |
32144659 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #179
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 186 - 281
Target Start/End: Complemental strand, 38555126 - 38555031
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataagtga |
281 |
Q |
| |
|
|||||||||||| |||||||| || | |||||||||||||||||||||| | |||||| |||| | ||||| ||||||||||| ||| |||||| |
|
|
| T |
38555126 |
cccgtgagcatagttcagttggcagagacaatgcattattatatgcaggggtc-gggttcgaacctcaaacacctcacttattcactttaaaagtga |
38555031 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #180
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 186 - 257
Target Start/End: Original strand, 40548303 - 40548374
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaat-gcattattatatgcagggaccggggttctaaccccggacac |
257 |
Q |
| |
|
||||||||| || |||||||||||||| || |||| |||||||||||| ||||||||| |||||||||||| |
|
|
| T |
40548303 |
cccgtgagcttagctcagttggtagggatattgcat-attatatgcaggagccggggttcgaaccccggacac |
40548374 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #181
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 186 - 281
Target Start/End: Complemental strand, 42824084 - 42823988
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataagtga |
281 |
Q |
| |
|
|||||||||||| ||||||||| ||| |||| ||||||||||| || || ||||||| || | ||||||||| |||||||||| ||| |||||| |
|
|
| T |
42824084 |
cccgtgagcataactcagttggcaggcacaatacattattatatacaagggttggggttcgaatctcggacaccctacttattcactttaaaagtga |
42823988 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #182
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 199 - 258
Target Start/End: Original strand, 44582734 - 44582794
Alignment:
| Q |
199 |
ctcagttggta-gggcaatgcattattatatgcagggaccggggttctaaccccggacacc |
258 |
Q |
| |
|
||||||||||| ||||||||||| || ||||||| || ||||||||| |||||||| |||| |
|
|
| T |
44582734 |
ctcagttggtatgggcaatgcataataatatgcaaggtccggggttcgaaccccggccacc |
44582794 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #183
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 221 - 273
Target Start/End: Complemental strand, 50676930 - 50676878
Alignment:
| Q |
221 |
tattatatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
||||||||| |||| ||||||| ||||||| |||||||||||||||||||| |
|
|
| T |
50676930 |
tattatatgtaggggttggggttcgaaccccgaacaccccacttattcacctt |
50676878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #184
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 190 - 270
Target Start/End: Original strand, 51017791 - 51017870
Alignment:
| Q |
190 |
tgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcac |
270 |
Q |
| |
|
|||| ||| ||||||||| |||| ||||||| ||||||||||| ||| |||| ||||| ||||||||||||||||||| |
|
|
| T |
51017791 |
tgagtatagctcagttggcagggacatgcattgttatatgcaggagtcggagttcgaaccc-ggacaccccacttattcac |
51017870 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr3; HSP #185
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 200 - 268
Target Start/End: Complemental strand, 51412074 - 51412006
Alignment:
| Q |
200 |
tcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattc |
268 |
Q |
| |
|
|||||||| |||| ||||||| ||||||||||| |||||||| || |||||| ||||||||||||| |
|
|
| T |
51412074 |
tcagttggcagggacatgcattgttatatgcaggagtcggggttcgaatcccggataccccacttattc |
51412006 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5 (Bit Score: 75; Significance: 1e-34; HSPs: 140)
Name: chr5
Description:
Target: chr5; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 184 - 278
Target Start/End: Original strand, 33800888 - 33800982
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||||||| ||||||||||||| |||||||||||||||||||||| ||||||||| |||||| |||||||||||||||||||||||||| |
|
|
| T |
33800888 |
gtcccgtgagcataactcagttggtaggacaatgcattattatatgcaggggccggggttcgaaccccagacaccccacttattcaccttataag |
33800982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #2
Raw Score: 72; E-Value: 9e-33
Query Start/End: Original strand, 183 - 278
Target Start/End: Complemental strand, 19059105 - 19059010
Alignment:
| Q |
183 |
tgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||||||||| ||||||||||||| ||||||||||| |||||||||| ||||||||| ||||| ||||||||||||||||||||||||||| |
|
|
| T |
19059105 |
tgtcccgtgagcatagctcagttggtaggacaatgcattatcatatgcaggggccggggttcgaaccctggacaccccacttattcaccttataag |
19059010 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #3
Raw Score: 71; E-Value: 3e-32
Query Start/End: Original strand, 180 - 278
Target Start/End: Complemental strand, 32158518 - 32158420
Alignment:
| Q |
180 |
aaatgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||||||||| || |||| |||||||| |||||||||||||||||||||| ||||||||| ||||||| ||||||||||||||||||||||||| |
|
|
| T |
32158518 |
aaatgtcccgtgagcttagctcaattggtaggacaatgcattattatatgcaggggccggggttcgaaccccgaacaccccacttattcaccttataag |
32158420 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #4
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 183 - 278
Target Start/End: Complemental strand, 20945992 - 20945897
Alignment:
| Q |
183 |
tgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||||||||| |||| |||||||| |||||||||||||||||||||| ||||||||| || ||||||||||||||||||||||||||||| |
|
|
| T |
20945992 |
tgtcccgtgagcataactcaattggtaggacaatgcattattatatgcaggggccggggttcgaaatccggacaccccacttattcaccttataag |
20945897 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #5
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 183 - 277
Target Start/End: Complemental strand, 843469 - 843375
Alignment:
| Q |
183 |
tgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataa |
277 |
Q |
| |
|
||||||||||||||| ||||||||||| | ||||||||||||||||| |||| |||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
843469 |
tgtcccgtgagcatatctcagttggtatgacaatgcattattatatgtaggggacggggttcgaaccccggacaccccacttattcaccttataa |
843375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #6
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 184 - 278
Target Start/End: Original strand, 8015830 - 8015924
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||||||| |||||| |||||| |||||||||||| |||||||| ||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
8015830 |
gtcccgtgagcatatctcagtcggtaggataatgcattattacatgcaggggccggggttcgaaccccggacaccccacttattcaccttataag |
8015924 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #7
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 188 - 278
Target Start/End: Original strand, 18478002 - 18478092
Alignment:
| Q |
188 |
cgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||| ||||||||||||| |||||||||||||||||| ||| ||||||||| ||||| ||||||||||||||||||||||||||| |
|
|
| T |
18478002 |
cgtgagcatagctcagttggtaggacaatgcattattatatgctggggccggggttcgaaccctggacaccccacttattcaccttataag |
18478092 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #8
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 185 - 274
Target Start/End: Original strand, 18872517 - 18872606
Alignment:
| Q |
185 |
tcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctta |
274 |
Q |
| |
|
||||||||||||| ||||||||||||| |||||||||||||||||||||| |||||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
18872517 |
tcccgtgagcatagctcagttggtaggacaatgcattattatatgcaggggtcggggttcgaaccccgaacaccccacttattcacctta |
18872606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #9
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 189 - 278
Target Start/End: Complemental strand, 29096403 - 29096314
Alignment:
| Q |
189 |
gtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||| ||||||||||||| ||||||||||||||||||| || |||| |||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
29096403 |
gtgagcatagctcagttggtaggacaatgcattattatatgcaagggccggagttcgaaccccggacaccccacttattcaccttataag |
29096314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #10
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 182 - 278
Target Start/End: Original strand, 42595734 - 42595830
Alignment:
| Q |
182 |
atgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||||||||| |||| |||||||| |||| |||||||||||||||||||||||||| ||||||| ||||||||||||||||||| ||||| |
|
|
| T |
42595734 |
atgtcccgtgagcatagctcaattggtaggacaatacattattatatgcagggaccggggtttgaaccccgaacaccccacttattcacctcataag |
42595830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #11
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 184 - 278
Target Start/End: Complemental strand, 27219663 - 27219569
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||||||| || |||||||||| ||||||||||||||||||| || ||||||||| ||||||| ||||||||||||||||||| ||||| |
|
|
| T |
27219663 |
gtcccgtgagcatagcttagttggtaggacaatgcattattatatgcatgggccggggttcaaaccccgtacaccccacttattcacctaataag |
27219569 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #12
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 189 - 281
Target Start/End: Original strand, 1463870 - 1463963
Alignment:
| Q |
189 |
gtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataagtga |
281 |
Q |
| |
|
||||||||| ||||||||| |||| |||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||| ||| |||||| |
|
|
| T |
1463870 |
gtgagcatagctcagttggcagggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttattcactttaaaagtga |
1463963 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #13
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 184 - 278
Target Start/End: Original strand, 33729772 - 33729867
Alignment:
| Q |
184 |
gtcccgtgagcat-acctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||||||| | ||||||||||||| |||||||||||||||||||||| ||||||||| || | | |||||||||||||||||||||||||| |
|
|
| T |
33729772 |
gtcccgtgagcattaactcagttggtaggacaatgcattattatatgcaggggccggggttcgaatctcagacaccccacttattcaccttataag |
33729867 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #14
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 199 - 278
Target Start/End: Complemental strand, 42455479 - 42455400
Alignment:
| Q |
199 |
ctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||| |||| |||| |||||||||||| |||||||||||||||||||| |
|
|
| T |
42455479 |
ctcagttggtaggacaatgcattattatatgcaggggccggagttcgaaccccggacactccacttattcaccttataag |
42455400 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #15
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 180 - 278
Target Start/End: Complemental strand, 1244831 - 1244733
Alignment:
| Q |
180 |
aaatgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||| ||||||||| | ||||||||||| ||| |||||||||||||||||| | |||||| |||||| |||||||||||||||||||||||||| |
|
|
| T |
1244831 |
aaatgtcctgtgagcatagcacagttggtaggacaaagcattattatatgcaggggtcagggttcgaaccccagacaccccacttattcaccttataag |
1244733 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #16
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 184 - 278
Target Start/End: Complemental strand, 2029228 - 2029134
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||||||| || |||||||||| ||||| |||||||||||||||| |||| ||| ||||||| ||||||||||||||||||||||||| |
|
|
| T |
2029228 |
gtcccgtgagcataacttagttggtaggacaatgtattattatatgcaggggtcgggattcgaaccccgaacaccccacttattcaccttataag |
2029134 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #17
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 185 - 270
Target Start/End: Complemental strand, 6447580 - 6447494
Alignment:
| Q |
185 |
tcccgtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcac |
270 |
Q |
| |
|
||||||||||||| ||||||||| |||| |||||||||||||||||||||| ||||||||| |||| |||||||||||||||||||| |
|
|
| T |
6447580 |
tcccgtgagcataactcagttggcagggacaatgcattattatatgcaggggccggggttcgaacctcggacaccccacttattcac |
6447494 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #18
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 184 - 278
Target Start/End: Complemental strand, 6614138 - 6614044
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||| ||||||| ||||| |||||| |||||||||||||||||||||| ||||||||| |||| ||||||||||||||||||| |||||||| |
|
|
| T |
6614138 |
gtcccgcgagcataactcagctggtagaacaatgcattattatatgcaggggccggggttcgaacctcggacaccccacttattcatcttataag |
6614044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #19
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 188 - 278
Target Start/End: Original strand, 29841347 - 29841437
Alignment:
| Q |
188 |
cgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||| ||||||||||||| ||||||||||||||||||| || ||| | ||| ||||||||||||||||||||||| ||||||||| |
|
|
| T |
29841347 |
cgtgagcatagctcagttggtaggacaatgcattattatatgcaagggccgagattcgaaccccggacaccccacttattccccttataag |
29841437 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #20
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 188 - 278
Target Start/End: Original strand, 30403749 - 30403839
Alignment:
| Q |
188 |
cgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||| ||||||||||||| |||| ||||||||||| ||||| |||| ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
30403749 |
cgtgagcataactcagttggtaggacaatacattattatatacaggggccggagtttgaaccccggacaccccacttattcaccttataag |
30403839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #21
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 184 - 278
Target Start/End: Complemental strand, 36888193 - 36888099
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||||||| ||||||||||||| |||||||||||||||||||||| |||||||| || || ||| |||||||||||||| |||||||| |
|
|
| T |
36888193 |
gtcccgtgagcatatctcagttggtaggacaatgcattattatatgcaggggccggggttggaatcctggagaccccacttattcatcttataag |
36888099 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #22
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 183 - 278
Target Start/End: Original strand, 10508574 - 10508669
Alignment:
| Q |
183 |
tgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||| |||| ||||||||||||| ||||| |||||||||||||||| || ||||| || || ||||||||||||||||||||||||||| |
|
|
| T |
10508574 |
tgtcccgtgaacatagctcagttggtaggacaatgtattattatatgcaggggccacggttcgaaacctggacaccccacttattcaccttataag |
10508669 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #23
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 183 - 278
Target Start/End: Complemental strand, 40339200 - 40339106
Alignment:
| Q |
183 |
tgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||||||||| ||||||| ||||| |||||||||||||||||||||| ||||||||| || || |||||||| | |||||||||||||||| |
|
|
| T |
40339200 |
tgtcccgtgagcatagctcagttagtaggacaatgcattattatatgcaggggccggggttcgaa-cctggacacccaatttattcaccttataag |
40339106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #24
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 184 - 279
Target Start/End: Complemental strand, 42801541 - 42801446
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataagt |
279 |
Q |
| |
|
||||||||| |||| ||||||||||| | ||||||||||||||||||||| |||||||| ||||||||||||| |||||||||| ||||||||| |
|
|
| T |
42801541 |
gtcccgtgatcatagctcagttggtatgataatgcattattatatgcaggggtcggggttcgaaccccggacacctcacttattcatcttataagt |
42801446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #25
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 188 - 281
Target Start/End: Complemental strand, 4674912 - 4674818
Alignment:
| Q |
188 |
cgtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataagtga |
281 |
Q |
| |
|
|||||||||| |||||||| |||| |||||||||||||||||||||| |||||||| ||||||||||||||||||||||||| ||| |||||| |
|
|
| T |
4674912 |
cgtgagcatagctcagttgacagggacaatgcattattatatgcaggggtcggggttcgaaccccggacaccccacttattcactttaaaagtga |
4674818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #26
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 180 - 278
Target Start/End: Complemental strand, 26302597 - 26302500
Alignment:
| Q |
180 |
aaatgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||| ||||||||||| ||| ||||||||| |||||||||||||||| ||||| |||| |||| |||| ||||||||||||||||||| |||||||| |
|
|
| T |
26302597 |
aaatgttccgtgagcatagctcggttggtaggacaatgcattattatatacaggg-ccggagttcgaacctcggacaccccacttattcatcttataag |
26302500 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #27
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 184 - 278
Target Start/End: Complemental strand, 29106138 - 29106044
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||| ||||||||| |||| |||||||| |||||||||||||||||||||| ||| |||| ||||| |||||||||||||||||||||||||| |
|
|
| T |
29106138 |
gtcctgtgagcatagctcaattggtaggacaatgcattattatatgcaggggccgaagttcgaaccctagacaccccacttattcaccttataag |
29106044 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #28
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 185 - 278
Target Start/End: Complemental strand, 42618513 - 42618419
Alignment:
| Q |
185 |
tcccgtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||||||||||||||||| |||| |||||||||||||||| ||||| |||||||| || |||||| ||||||||||||||| ||||||| |
|
|
| T |
42618513 |
tcccgtgagcatacctcagttggcagggacaatgcattattatatacaggggtcggggttcgaatcccggataccccacttattcactttataag |
42618419 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #29
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 184 - 277
Target Start/End: Complemental strand, 21017706 - 21017613
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataa |
277 |
Q |
| |
|
||||||||| |||| ||||||||||||| ||||||||||||||||| || | | |||||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
21017706 |
gtcccgtgaacatagctcagttggtaggacaatgcattattatatgtagtggctggggtttgaaccccggacatcccacttattcaccttataa |
21017613 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #30
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 184 - 277
Target Start/End: Complemental strand, 22600035 - 22599943
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataa |
277 |
Q |
| |
|
|||||||||||||| ||||||||||||| |||||||||||||||||||||| ||| || |||||| ||||||||||||||||||||||||| |
|
|
| T |
22600035 |
gtcccgtgagcataactcagttggtaggacaatgcattattatatgcaggg-ttgggatttgaaccccagacaccccacttattcaccttataa |
22599943 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #31
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 192 - 276
Target Start/End: Complemental strand, 2411386 - 2411302
Alignment:
| Q |
192 |
agcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttata |
276 |
Q |
| |
|
|||||| ||||||||||||| ||||| |||||||||||||||| |||| |||| |||||| ||||||||||||||||| |||||| |
|
|
| T |
2411386 |
agcatagctcagttggtaggacaatgtattattatatgcaggggccggagttcgaaccccagacaccccacttattcatcttata |
2411302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #32
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 186 - 281
Target Start/End: Complemental strand, 20735274 - 20735178
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataagtga |
281 |
Q |
| |
|
||||||| |||| ||||||||| |||| ||||||||||||||||| |||| ||||||||| || |||||||||||||||||||||| ||| |||||| |
|
|
| T |
20735274 |
cccgtgaacatagctcagttggcagggacaatgcattattatatgtaggggccggggttcgaatcccggacaccccacttattcactttaaaagtga |
20735178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #33
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 212 - 270
Target Start/End: Original strand, 10943739 - 10943797
Alignment:
| Q |
212 |
gcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcac |
270 |
Q |
| |
|
||||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
10943739 |
gcaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttattcac |
10943797 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #34
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 188 - 278
Target Start/End: Original strand, 23925542 - 23925632
Alignment:
| Q |
188 |
cgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||| |||||||| |||| |||||||||||||||||||||| | |||||| || |||||| |||||||||||||| |||||||| |
|
|
| T |
23925542 |
cgtgagcataactcagttgataggacaatgcattattatatgcaggggtctgggttcgaatcccggataccccacttattcatcttataag |
23925632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #35
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 184 - 261
Target Start/End: Original strand, 29050795 - 29050872
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacacccca |
261 |
Q |
| |
|
|||||| ||||||| ||||||||||||| |||||||||||||||||||||| |||||||| ||| |||||||||||| |
|
|
| T |
29050795 |
gtcccgcgagcatagctcagttggtaggacaatgcattattatatgcaggggccggggtttgaactccggacacccca |
29050872 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #36
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 185 - 281
Target Start/End: Complemental strand, 36045234 - 36045137
Alignment:
| Q |
185 |
tcccgtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataagtga |
281 |
Q |
| |
|
||||||||||||| |||||||| | | |||||||||||||||||||||| |||||||| ||||||||||||||||||||||||| ||| |||||| |
|
|
| T |
36045234 |
tcccgtgagcatagctcagttgacaagaacaatgcattattatatgcaggggtcggggttcgaaccccggacaccccacttattcactttaaaagtga |
36045137 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #37
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 186 - 270
Target Start/End: Original strand, 37303930 - 37304015
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcac |
270 |
Q |
| |
|
|||||||||||| ||||||||| |||| ||||| |||||||||||||||| |||||||| ||||| ||||||||||||||||||| |
|
|
| T |
37303930 |
cccgtgagcatagctcagttggcagggacaatgtattattatatgcaggggtcggggttcgaaccctggacaccccacttattcac |
37304015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #38
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 186 - 274
Target Start/End: Complemental strand, 3536034 - 3535946
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctta |
274 |
Q |
| |
|
|||||||||||| |||||||| |||| ||||||| |||||| |||| ||||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
3536034 |
cccgtgagcatagttcagttggcagggacatgcattgttatatacaggagccggggttcgaaccccggacaccccacttattcacctta |
3535946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #39
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 190 - 278
Target Start/End: Complemental strand, 27440392 - 27440304
Alignment:
| Q |
190 |
tgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||| ||||||||||||| |||||||||||||||||||| | || ||||| ||||||| |||||| || ||||||||||||||| |
|
|
| T |
27440392 |
tgagcatagctcagttggtaggacaatgcattattatatgcagtggtcgaggttcgaaccccgaacaccctacatattcaccttataag |
27440304 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #40
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 184 - 242
Target Start/End: Complemental strand, 9176886 - 9176828
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggt |
242 |
Q |
| |
|
|||||||||||||| ||||||||| ||| |||||||||||||||||||||||||||||| |
|
|
| T |
9176886 |
gtcccgtgagcataactcagttggaaggacaatgcattattatatgcagggaccggggt |
9176828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #41
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 186 - 284
Target Start/End: Complemental strand, 18102047 - 18101949
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataagtgatga |
284 |
Q |
| |
|
|||||||||||| ||| |||| ||| | ||| |||||||||||||||| |||| |||| |||||| |||||||||||||||||||||| || |||||| |
|
|
| T |
18102047 |
cccgtgagcatagctcggttgatagagacatgtattattatatgcaggggccggagttcgaaccccagacaccccacttattcaccttaaaaatgatga |
18101949 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #42
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 186 - 268
Target Start/End: Original strand, 25660909 - 25660991
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattc |
268 |
Q |
| |
|
|||||||||||| ||||||||| |||| ||||||| |||||||||||| ||||| ||| |||||| |||||||||||||||| |
|
|
| T |
25660909 |
cccgtgagcatagctcagttggcagggatatgcattgttatatgcaggggccgggattcgaaccccagacaccccacttattc |
25660991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #43
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 220 - 278
Target Start/End: Complemental strand, 38618745 - 38618687
Alignment:
| Q |
220 |
ttattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||||| || ||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
38618745 |
ttattatatgcaagggccggggttcgaaccccggacaccccacttattcaccttataag |
38618687 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #44
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 202 - 267
Target Start/End: Complemental strand, 973058 - 972993
Alignment:
| Q |
202 |
agttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttatt |
267 |
Q |
| |
|
|||||||||| |||||||||||||||| ||||| ||||||||| |||||||||| ||||||||||| |
|
|
| T |
973058 |
agttggtaggacaatgcattattatatacaggggccggggttcgaaccccggaccccccacttatt |
972993 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #45
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 186 - 278
Target Start/End: Complemental strand, 6806739 - 6806646
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||||| ||||||||| || | ||||||||| |||||||||||| |||| ||| |||||||||||| |||||||||||| ||||||| |
|
|
| T |
6806739 |
cccgtgagcatagctcagttggcagagacaatgcattgttatatgcaggggtcgggattcgaaccccggacactccacttattcacattataag |
6806646 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #46
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 189 - 278
Target Start/End: Original strand, 29144142 - 29144231
Alignment:
| Q |
189 |
gtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||| || ||||||||||||| |||||||||||||||||||||| ||||||| ||| || ||||||||| |||||||| ||||||| |
|
|
| T |
29144142 |
gtgagcttaactcagttggtaggacaatgcattattatatgcaggggtcggggtttgaactccagacaccccatttattcacgttataag |
29144231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #47
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 183 - 251
Target Start/End: Original strand, 9577296 - 9577364
Alignment:
| Q |
183 |
tgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaacccc |
251 |
Q |
| |
|
||||||||||| ||| ||||||||||||| ||||||||||||||||||| || ||||||||| |||||| |
|
|
| T |
9577296 |
tgtcccgtgagtataactcagttggtaggacaatgcattattatatgcatgggccggggttcgaacccc |
9577364 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #48
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 183 - 274
Target Start/End: Complemental strand, 27025531 - 27025439
Alignment:
| Q |
183 |
tgtcccgtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctta |
274 |
Q |
| |
|
||||||||||||||| |||| |||| ||| ||||||||| |||||| ||||| || |||||| |||||| |||||||||||||||||||||| |
|
|
| T |
27025531 |
tgtcccgtgagcatagctcatttggccgggacaatgcattgttatattcaggggcctgggttcgaaccccagacaccccacttattcacctta |
27025439 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #49
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 199 - 278
Target Start/End: Original strand, 6561908 - 6561987
Alignment:
| Q |
199 |
ctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||||||| ||||||||||| |||||||||| ||| |||| ||| ||| ||||||||| ||||||||||||||| |
|
|
| T |
6561908 |
ctcagttggtaggataatgcattattttatgcagggatcggagttcgaactccgaacaccccacatattcaccttataag |
6561987 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #50
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 187 - 278
Target Start/End: Original strand, 14487559 - 14487650
Alignment:
| Q |
187 |
ccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||| ||| |||||||||||| ||||||||||||||||| |||| ||||||| |||| |||| | ||||||||||||||||||||| |
|
|
| T |
14487559 |
ccgtgaggataattcagttggtaggacaatgcattattatatgtaggggttggggttcgaacctcggatatcccacttattcaccttataag |
14487650 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #51
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 187 - 273
Target Start/End: Original strand, 20186864 - 20186948
Alignment:
| Q |
187 |
ccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
|||||||||| ||||||||| |||| |||||||||||||||||||| |||||| ||||||| ||||||||||||||||||||| |
|
|
| T |
20186864 |
ccgtgagcattgctcagttggcagggacatgcattattatatgcaggggtcggggt--taaccccagacaccccacttattcacctt |
20186948 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #52
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 215 - 273
Target Start/End: Complemental strand, 17137936 - 17137878
Alignment:
| Q |
215 |
atgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
||||||||||||||||||||| |||||||| |||||| ||||| ||||||||||||||| |
|
|
| T |
17137936 |
atgcattattatatgcagggatcggggttcgaacccccgacactccacttattcacctt |
17137878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #53
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 184 - 278
Target Start/End: Complemental strand, 21959479 - 21959385
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||||||| ||||||| |||| ||||||||||| ||||||||| | || ||| ||||||| |||||||| |||||||||||||||| |
|
|
| T |
21959479 |
gtcccgtgagcatagctcagttagtagaataatgcattattttatgcaggggctggagttggaaccccgaacaccccatttattcaccttataag |
21959385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #54
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 183 - 269
Target Start/End: Complemental strand, 42070652 - 42070566
Alignment:
| Q |
183 |
tgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattca |
269 |
Q |
| |
|
||||| || |||||| |||||||||||| ||||||||||||||||||| |||||| |||| ||||| ||| |||||||||||||| |
|
|
| T |
42070652 |
tgtcctgtaagcatagctcagttggtagaacaatgcattattatatgcacggaccgaagttcgaaccctggagaccccacttattca |
42070566 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #55
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 184 - 278
Target Start/End: Original strand, 43404377 - 43404471
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||| |||||||| ||||||||||||| |||||||||||| ||||||||| || | ||| ||| | |||||||||| ||||| |||||||||| |
|
|
| T |
43404377 |
gtcccttgagcatagctcagttggtaggacaatgcattattgtatgcaggggccagagtttgaactctggacaccccatttatttaccttataag |
43404471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #56
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 186 - 277
Target Start/End: Original strand, 9963412 - 9963504
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataa |
277 |
Q |
| |
|
|||||||| ||| ||||||||| |||| ||||||||| |||||||||||| ||||||| ||| ||||| ||||||||||||||||||||| |
|
|
| T |
9963412 |
cccgtgagtatagctcagttggcagggacaatgcattgttatatgcaggggttggggttcgaacttcggaccccccacttattcaccttataa |
9963504 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #57
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 190 - 274
Target Start/End: Original strand, 19608614 - 19608698
Alignment:
| Q |
190 |
tgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctta |
274 |
Q |
| |
|
|||||||| |||||||| |||| |||||||||||||||||||| |||||||| ||| |||||||| ||||||||||||||| |
|
|
| T |
19608614 |
tgagcatagctcagttgataggaatatgcattattatatgcaggggtcggggttcgaactccggacacttcacttattcacctta |
19608698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #58
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 182 - 274
Target Start/End: Complemental strand, 20699527 - 20699436
Alignment:
| Q |
182 |
atgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctta |
274 |
Q |
| |
|
||||| ||||| |||| ||||||||||||| |||||||||||||||||| ||| | | |||| || | |||||||||||||||||||||||| |
|
|
| T |
20699527 |
atgtctcgtgaccatagctcagttggtaggacaatgcattattatatgc-ggggctgaagttcgaaactcggacaccccacttattcacctta |
20699436 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #59
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 199 - 278
Target Start/End: Complemental strand, 26169097 - 26169020
Alignment:
| Q |
199 |
ctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||| || |||| ||||||||||| | |||||||||||||||||| |
|
|
| T |
26169097 |
ctcagttggtaggacaatgcattattatatgcaggggttggagttcgaaccccggaca--cgacttattcaccttataag |
26169020 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #60
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 186 - 270
Target Start/End: Original strand, 28537132 - 28537216
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcac |
270 |
Q |
| |
|
|||||||||||| |||| ||| | || ||||||| ||||||||| || ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
28537132 |
cccgtgagcataactcaattgacatggacatgcattgttatatgcatgggccggggttcgaaccccggacaccccacttattcac |
28537216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #61
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 219 - 279
Target Start/End: Complemental strand, 34921179 - 34921119
Alignment:
| Q |
219 |
attattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataagt |
279 |
Q |
| |
|
|||||||||||||||| |||||||||||||| |||| |||||||||||||||||||||| |
|
|
| T |
34921179 |
attattatatgcaggggtcggggttctaacccaagacatcccacttattcaccttataagt |
34921119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #62
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 186 - 264
Target Start/End: Complemental strand, 13622016 - 13621938
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaat-gcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||||||| || |||||||||||||| || |||| ||||||||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
13622016 |
cccgtgagcttagctcagttggtagggatatcgcat-attatatgcaggggccggggttcgaaccccggacaccccactt |
13621938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #63
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 183 - 278
Target Start/End: Original strand, 13754000 - 13754095
Alignment:
| Q |
183 |
tgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||| | |||| ||||||||||||| |||| ||||||||||||||||| || |||| ||| ||||||||||| ||||||| |||||||| |
|
|
| T |
13754000 |
tgtcccgtaaacataactcagttggtaggacaatacattattatatgcaggggtcgatgttcgaacgtcggacaccccatttattcatcttataag |
13754095 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #64
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 186 - 273
Target Start/End: Original strand, 31556815 - 31556902
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
||||| |||||| |||| || | |||| ||||||| |||||||||||| ||| |||| |||||||||||||||||||||||||||| |
|
|
| T |
31556815 |
cccgttagcatagctcacttagcagggacatgcattgttatatgcaggggtcggagttcgaaccccggacaccccacttattcacctt |
31556902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #65
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 215 - 274
Target Start/End: Original strand, 40384277 - 40384336
Alignment:
| Q |
215 |
atgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctta |
274 |
Q |
| |
|
|||||||||||||||||| | | ||||||| ||| ||||||||||||||||||||||||| |
|
|
| T |
40384277 |
atgcattattatatgcagcggctggggttcgaactccggacaccccacttattcacctta |
40384336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #66
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 188 - 278
Target Start/End: Original strand, 6014778 - 6014868
Alignment:
| Q |
188 |
cgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||| |||| || |||| ||||| |||||||||||||||| ||||| ||||||| ||| ||||||||| |||||||||| |||||||| |
|
|
| T |
6014778 |
cgtgaacatagctgagtttgtaggataatgcattattatatgtagggatcggggtttgaactccggacacctcacttattcatcttataag |
6014868 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #67
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 200 - 278
Target Start/End: Complemental strand, 7234956 - 7234878
Alignment:
| Q |
200 |
tcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||| |||||| ||||||||||||||||| || | |||||||| |||||| || |||||| |||||||||||||||| |
|
|
| T |
7234956 |
tcagtcggtaggacaatgcattattatatgtagaggtcggggttcgaaccccagataccccatttattcaccttataag |
7234878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #68
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 187 - 269
Target Start/End: Complemental strand, 11246591 - 11246509
Alignment:
| Q |
187 |
ccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattca |
269 |
Q |
| |
|
||||||||||| ||||||||| |||| ||||||| |||||||||||| ||||| || |||||| |||| |||||||||||| |
|
|
| T |
11246591 |
ccgtgagcatagctcagttggcagggacatgcattgttatatgcaggggtcggggctcaaaccccagacatcccacttattca |
11246509 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #69
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 185 - 264
Target Start/End: Complemental strand, 17891931 - 17891851
Alignment:
| Q |
185 |
tcccgtgagcatacctcagttggtagggc--aatgcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
|||||||||| | |||||||||||||| |||||||| |||||||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
17891931 |
tcccgtgagctttgctcagttggtagggacaaatgcatt-ttatatgcaggggccggggttcgaaccccggacaccccactt |
17891851 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #70
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 202 - 276
Target Start/End: Complemental strand, 19454032 - 19453958
Alignment:
| Q |
202 |
agttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttata |
276 |
Q |
| |
|
||||||||| |||||||||||||||| ||||| | | |||| ||||| ||||||||||||||||||||||||| |
|
|
| T |
19454032 |
agttggtagcacaatgcattattatatacaggggctgaggtttaaaccctggacaccccacttattcaccttata |
19453958 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #71
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 188 - 278
Target Start/End: Original strand, 20762280 - 20762370
Alignment:
| Q |
188 |
cgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||| ||| |||||||||||| |||||||||||||||| | | ||||||| ||||| ||||||||||||||||||||||||||| |
|
|
| T |
20762280 |
cgtgagtatagctcagttggtagaacaatgcattattatatataacggttggggttcgaaccctggacaccccacttattcaccttataag |
20762370 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #72
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 214 - 276
Target Start/End: Complemental strand, 28378135 - 28378073
Alignment:
| Q |
214 |
aatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttata |
276 |
Q |
| |
|
|||||||||||||||| |||| ||||||| ||||||| ||||||||||||||||||||||| |
|
|
| T |
28378135 |
aatgcattattatatgtaggggttggggttcgaaccccgaacaccccacttattcaccttata |
28378073 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #73
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 186 - 267
Target Start/End: Complemental strand, 7147117 - 7147036
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttatt |
267 |
Q |
| |
|
|||||||||||| ||||||||||| || |||||||||||||||||||| |||||||| |||| | |||||| || ||||| |
|
|
| T |
7147117 |
cccgtgagcatagctcagttggtaaggacatgcattattatatgcaggggtcggggttcgaacctctgacacctcatttatt |
7147036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #74
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 185 - 278
Target Start/End: Complemental strand, 7645201 - 7645108
Alignment:
| Q |
185 |
tcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||||||| || |||||||||| |||||||||||||||||||| | || |||| || ||||||| ||||||||||||||||||| |
|
|
| T |
7645201 |
tcccgtgagcatagcttagttggtaggacaatgcattattatatgcagaggttggagttcaaattttggacacctcacttattcaccttataag |
7645108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #75
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 194 - 278
Target Start/End: Complemental strand, 9409041 - 9408956
Alignment:
| Q |
194 |
catacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||| ||||||||| |||| ||||||||| |||||||||||| ||| |||| ||||||||||||| || ||||||| |||||||| |
|
|
| T |
9409041 |
cataactcagttggcagggacaatgcattgttatatgcaggggtcggagttcgaaccccggacacctcatttattcaacttataag |
9408956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #76
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 185 - 281
Target Start/End: Complemental strand, 37417229 - 37417133
Alignment:
| Q |
185 |
tcccgtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataagtga |
281 |
Q |
| |
|
|||||||||| || ||||||||| |||| |||| ||||||||||||||||| || |||||| || ||| ||||||||||||| |||| ||| |||||| |
|
|
| T |
37417229 |
tcccgtgagcttagctcagttggcagggacaatacattattatatgcaggggccagggttcgaa-ccctgacaccccacttactcactttaaaagtga |
37417133 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #77
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 185 - 277
Target Start/End: Original strand, 15570107 - 15570198
Alignment:
| Q |
185 |
tcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataa |
277 |
Q |
| |
|
|||| |||||||| |||||||||||| ||||||||| |||||| |||| |||||||| || ||| ||||||||| ||||||||||||||| |
|
|
| T |
15570107 |
tcccatgagcataactcagttggtagtacaatgcattgctatatgtaggggtcggggttc-aaacccagacaccccatttattcaccttataa |
15570198 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #78
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 226 - 274
Target Start/End: Original strand, 16263775 - 16263823
Alignment:
| Q |
226 |
tatgcagggaccggggttctaaccccggacaccccacttattcacctta |
274 |
Q |
| |
|
||||||||| ||||||||||||||||||| |||||||||||||||||| |
|
|
| T |
16263775 |
tatgcaggggccggggttctaaccccggattccccacttattcacctta |
16263823 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #79
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 186 - 274
Target Start/End: Original strand, 17557027 - 17557114
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctta |
274 |
Q |
| |
|
||||||||| || ||||||||| || | ||||||| ||||||| |||| |||||||| ||||| ||||||||||||||||||||||| |
|
|
| T |
17557027 |
cccgtgagcctaactcagttggcagagacatgcattgttatatgtaggggtcggggttcaaaccc-ggacaccccacttattcacctta |
17557114 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #80
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 186 - 263
Target Start/End: Complemental strand, 23938004 - 23937926
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggc--aatgcattattatatgcagggaccggggttctaaccccggacaccccact |
263 |
Q |
| |
|
||||||||| | |||||||||||||| |||||||| |||||||||||| ||||||||| |||||||||||||||||| |
|
|
| T |
23938004 |
cccgtgagctttgctcagttggtagggacaaatgcatt-ttatatgcaggggccggggttcgaaccccggacaccccact |
23937926 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #81
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 200 - 276
Target Start/End: Original strand, 34010546 - 34010622
Alignment:
| Q |
200 |
tcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttata |
276 |
Q |
| |
|
|||||||||||| |||||||||||||||| |||| ||| |||| ||||||||||| | || |||||||||||||| |
|
|
| T |
34010546 |
tcagttggtaggacaatgcattattatatataggggtcggagttcgaaccccggacatctcatttattcaccttata |
34010622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #82
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 186 - 264
Target Start/End: Original strand, 4067982 - 4068060
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||||||| || |||||||||||||| |||||||| ||| ||||||||| || ||||| ||||||||||||||||||| |
|
|
| T |
4067982 |
cccgtgagcttagctcagttggtagggacaatgcat-attttatgcagggggcgaggttcgaaccccggacaccccactt |
4068060 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #83
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 186 - 269
Target Start/End: Original strand, 10106627 - 10106710
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattca |
269 |
Q |
| |
|
|||| ||||||| ||||||||| |||| || |||||||||||| |||| || |||| |||||||||||||||||||||||| |
|
|
| T |
10106627 |
cccgcgagcatagctcagttggcagggacatccattattatatgtaggggccaaagttcgaaccccggacaccccacttattca |
10106710 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #84
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 186 - 264
Target Start/End: Original strand, 12891557 - 12891635
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaat-gcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||||||| || |||||||||||||| || |||| |||||||| |||| ||||||||| ||||||||||||||||||| |
|
|
| T |
12891557 |
cccgtgagcttagctcagttggtagggatattgcat-attatatgtaggggccggggttcgaaccccggacaccccactt |
12891635 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #85
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 186 - 264
Target Start/End: Complemental strand, 17545242 - 17545164
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaat-gcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||||||| || |||||||||||||| || |||| ||||||||||||| ||||||||| |||||||||||| |||||| |
|
|
| T |
17545242 |
cccgtgagcttagctcagttggtagggatattgcat-attatatgcaggggccggggttcgaaccccggacactccactt |
17545164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #86
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 214 - 281
Target Start/End: Original strand, 25346209 - 25346276
Alignment:
| Q |
214 |
aatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataagtga |
281 |
Q |
| |
|
||||||| |||||||||||| ||||||||| || |||||||||||||| ||||||| ||| |||||| |
|
|
| T |
25346209 |
aatgcatggttatatgcaggggccggggttcgaatcccggacaccccacgtattcactttaaaagtga |
25346276 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #87
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 186 - 273
Target Start/End: Original strand, 27006337 - 27006424
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
|||||||||||| |||| ||| |||| ||||||| |||||||| ||| |||||||| ||| |||||||| ||||||||||||||| |
|
|
| T |
27006337 |
cccgtgagcataggtcagatggcaggggcatgcattgttatatgctggggtcggggttcgaactccggacactccacttattcacctt |
27006424 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #88
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 187 - 270
Target Start/End: Complemental strand, 31934972 - 31934889
Alignment:
| Q |
187 |
ccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcac |
270 |
Q |
| |
|
|||||| |||| ||||||||||||| |||||||||||||||||||| || | ||||| || ||||||||||| |||||||| |
|
|
| T |
31934972 |
ccgtgaacataactcagttggtaggacaatgcattattatatgcagagattgaggttcgaatttcggacaccccatttattcac |
31934889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #89
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 185 - 260
Target Start/End: Complemental strand, 36742066 - 36741991
Alignment:
| Q |
185 |
tcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacacccc |
260 |
Q |
| |
|
||||||||||||| ||||||||| || | ||| ||| ||||||||||||| |||||||| ||||| ||||||||| |
|
|
| T |
36742066 |
tcccgtgagcatagctcagttggcagagacatgaattgttatatgcagggatcggggttcgaaccctggacacccc |
36741991 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #90
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 192 - 278
Target Start/End: Complemental strand, 15978769 - 15978683
Alignment:
| Q |
192 |
agcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||| || |||||||||| ||||| ||||||||||| |||| | |||| |||||| ||||||||||||||||||||||||| |
|
|
| T |
15978769 |
agcataacttagttggtaggacaatgtattattatatgtaggggatgaggtttgaaccccaaacaccccacttattcaccttataag |
15978683 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #91
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 223 - 273
Target Start/End: Original strand, 20191475 - 20191525
Alignment:
| Q |
223 |
ttatatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||| ||||||||||||||| |
|
|
| T |
20191475 |
ttatatgcaggggtcggggttcgaaccccggacactccacttattcacctt |
20191525 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #92
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 215 - 269
Target Start/End: Complemental strand, 22397057 - 22397003
Alignment:
| Q |
215 |
atgcattattatatgcagggaccggggttctaaccccggacaccccacttattca |
269 |
Q |
| |
|
|||||||||||||| || | || ||||||| |||||||||||||||||||||||| |
|
|
| T |
22397057 |
atgcattattatatacaagaacaggggttcgaaccccggacaccccacttattca |
22397003 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #93
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 200 - 274
Target Start/End: Original strand, 24205447 - 24205520
Alignment:
| Q |
200 |
tcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctta |
274 |
Q |
| |
|
|||||||||||| ||||||||| ||||||| |||| | || ||| |||||||||||||||||||||| |||||| |
|
|
| T |
24205447 |
tcagttggtaggacaatgcattgttatatgtaggggtcagg-ttcgaaccccggacaccccacttatttacctta |
24205520 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #94
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 184 - 234
Target Start/End: Original strand, 29266063 - 29266113
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcaggg |
234 |
Q |
| |
|
|||||||||||||| |||| ||| |||| |||||||||||||||||||||| |
|
|
| T |
29266063 |
gtcccgtgagcatagctcaattgataggacaatgcattattatatgcaggg |
29266113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #95
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 186 - 268
Target Start/End: Complemental strand, 35813340 - 35813258
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattc |
268 |
Q |
| |
|
|||||||||||| |||||||| |||| ||||||| |||||||||||| | ||||| ||||| ||||||||||||||||| |
|
|
| T |
35813340 |
cccgtgagcatagctcagttgacagggacatgcattgttatatgcaggggctcaggttcgaacccaggacaccccacttattc |
35813258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #96
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 186 - 264
Target Start/End: Original strand, 42916389 - 42916467
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||||||| || |||||||||||||| || | |||||||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
42916389 |
cccgtgagcttagctcagttggtagggatattgtatgttatatgcaggggccggggttcgaaccccggacaccccactt |
42916467 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #97
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 228 - 269
Target Start/End: Original strand, 31250186 - 31250227
Alignment:
| Q |
228 |
tgcagggaccggggttctaaccccggacaccccacttattca |
269 |
Q |
| |
|
||||||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
31250186 |
tgcaggggccggggttcgaaccccggacaccccacttattca |
31250227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #98
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 228 - 269
Target Start/End: Complemental strand, 38503313 - 38503272
Alignment:
| Q |
228 |
tgcagggaccggggttctaaccccggacaccccacttattca |
269 |
Q |
| |
|
||||||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
38503313 |
tgcaggggccggggttcgaaccccggacaccccacttattca |
38503272 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #99
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 228 - 269
Target Start/End: Original strand, 43227905 - 43227946
Alignment:
| Q |
228 |
tgcagggaccggggttctaaccccggacaccccacttattca |
269 |
Q |
| |
|
||||||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
43227905 |
tgcaggggccggggttcgaaccccggacaccccacttattca |
43227946 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #100
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 189 - 264
Target Start/End: Complemental strand, 25400434 - 25400359
Alignment:
| Q |
189 |
gtgagcatacctcagttggtagggcaat-gcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||||||| |||||||||||||| || |||| |||||||||||| ||||||||| |||||||||||| |||||| |
|
|
| T |
25400434 |
gtgagcatagctcagttggtagggatattgcat-attatatgcaggagccggggttcgaaccccggacactccactt |
25400359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #101
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 185 - 273
Target Start/End: Complemental strand, 31280478 - 31280391
Alignment:
| Q |
185 |
tcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
||||||||||||| ||||||||| |||| ||| |||| ||||||||||| || ||||| ||||||| ||| ||||||||| |||||| |
|
|
| T |
31280478 |
tcccgtgagcatagctcagttggcagggacatgtattactatatgcaggggccaaggttcgaaccccgaaca-cccacttatccacctt |
31280391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #102
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 186 - 274
Target Start/End: Original strand, 34325262 - 34325350
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctta |
274 |
Q |
| |
|
||||||| ||| |||||||| |||| |||||||||||||||||||||| ||||||| || | || ||| || |||||||||||||| |
|
|
| T |
34325262 |
cccgtgaacatggctcagttgacagggacatgcattattatatgcagggactggggttcgaatctcgaacatccaacttattcacctta |
34325350 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #103
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 221 - 273
Target Start/End: Original strand, 34729504 - 34729555
Alignment:
| Q |
221 |
tattatatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
|||||||||||||| |||||||| ||||| |||||||||||||||||||||| |
|
|
| T |
34729504 |
tattatatgcaggggtcggggttcgaaccc-ggacaccccacttattcacctt |
34729555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #104
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 233 - 273
Target Start/End: Complemental strand, 35168683 - 35168643
Alignment:
| Q |
233 |
ggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
|||||| ||||| |||||||||||||||||||||||||||| |
|
|
| T |
35168683 |
ggaccgaggttcgaaccccggacaccccacttattcacctt |
35168643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #105
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 217 - 273
Target Start/End: Complemental strand, 38129080 - 38129024
Alignment:
| Q |
217 |
gcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
||||| |||||||||||| |||||||| ||||| |||||| ||||||||||||||| |
|
|
| T |
38129080 |
gcattgttatatgcaggggtcggggttcgaaccctggacactccacttattcacctt |
38129024 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #106
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 186 - 264
Target Start/End: Complemental strand, 4417755 - 4417677
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaat-gcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||||||| || |||||||||||||| || |||| |||||||||||| ||||||||| |||||||||||| |||||| |
|
|
| T |
4417755 |
cccgtgagcttagctcagttggtagggatattgcat-attatatgcaggagccggggttcgaaccccggacactccactt |
4417677 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #107
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 184 - 231
Target Start/End: Complemental strand, 4666546 - 4666499
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgca |
231 |
Q |
| |
|
|||||||||||||| |||| ||||||| ||||||||||||||||||| |
|
|
| T |
4666546 |
gtcccgtgagcatagctcaattggtagaacaatgcattattatatgca |
4666499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #108
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 186 - 264
Target Start/End: Original strand, 5966829 - 5966907
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaat-gcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||||||| || |||||||||||||| || |||| |||||||||||| ||||||||| |||||||||||| |||||| |
|
|
| T |
5966829 |
cccgtgagcgtagctcagttggtagggatattgcat-attatatgcaggagccggggttcgaaccccggacactccactt |
5966907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #109
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 199 - 278
Target Start/End: Complemental strand, 6671871 - 6671792
Alignment:
| Q |
199 |
ctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||||||| |||||||||||||||| ||| | | |||||| || ||||||| | |||||||||| |||||||| |
|
|
| T |
6671871 |
ctcagttggtaggacaatgcattattatatacagaaatcagggttcgaattccggacatctcacttattcatcttataag |
6671792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #110
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 214 - 273
Target Start/End: Original strand, 8934807 - 8934865
Alignment:
| Q |
214 |
aatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
|||||||||||||||||| || | ||||||| | ||||||| |||||||||||||||||| |
|
|
| T |
8934807 |
aatgcattattatatgcatggtc-ggggttcgagccccggataccccacttattcacctt |
8934865 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #111
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 186 - 264
Target Start/End: Original strand, 9835033 - 9835111
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaat-gcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||||||| || |||||||||||||| || |||| |||||||||||| ||||||||| |||||||||||| |||||| |
|
|
| T |
9835033 |
cccgtgagcttagctcagttggtagggatattgcat-attatatgcaggagccggggttcgaaccccggacactccactt |
9835111 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #112
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 186 - 264
Target Start/End: Original strand, 12463756 - 12463834
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaat-gcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||||||| || |||||||||||||| || |||| |||||||||||| ||||||||| |||||||||||| |||||| |
|
|
| T |
12463756 |
cccgtgagcttagctcagttggtagggatattgcat-attatatgcaggagccggggttcgaaccccggacactccactt |
12463834 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #113
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 186 - 264
Target Start/End: Original strand, 24033077 - 24033155
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaat-gcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
|||| |||| || |||||||||||||| || ||||| |||||||||||| ||||||||| |||||||||||| |||||| |
|
|
| T |
24033077 |
cccgcgagcttagctcagttggtagggatattgcatt-ttatatgcaggggccggggttcgaaccccggacacgccactt |
24033155 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #114
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 187 - 246
Target Start/End: Complemental strand, 26041662 - 26041603
Alignment:
| Q |
187 |
ccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttcta |
246 |
Q |
| |
|
|||| |||||| ||||||||||||| ||| ||||||||||||||||| |||||||||| |
|
|
| T |
26041662 |
ccgtaagcatatctcagttggtaggacaaaacattattatatgcaggggtcggggttcta |
26041603 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #115
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 180 - 270
Target Start/End: Complemental strand, 32253024 - 32252933
Alignment:
| Q |
180 |
aaatgtcc-cgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcac |
270 |
Q |
| |
|
|||||||| ||||| |||| |||||||| || || ||||||||||||||| |||| |||||||| |||||| ||||||| | |||||||| |
|
|
| T |
32253024 |
aaatgtcctcgtgaacatagctcagttgataaggacatgcattattatatgtaggggtcggggttcgaaccccagacacccaatttattcac |
32252933 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #116
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 186 - 264
Target Start/End: Original strand, 32505688 - 32505766
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaat-gcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||||||| || |||||||||||||| || |||| |||||||||||| ||||||||| |||||||||||| |||||| |
|
|
| T |
32505688 |
cccgtgagcttagctcagttggtagggatattgcat-attatatgcaggagccggggttcgaaccccggacactccactt |
32505766 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #117
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 186 - 264
Target Start/End: Complemental strand, 39800100 - 39800022
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||||||| || |||||||||||||| |||||||| ||| ||||||||| | |||| || |||||| |||||||||||| |
|
|
| T |
39800100 |
cccgtgagcttagctcagttggtagggacaatgcataatt-tatgcaggggcaggggctcgaacccctgacaccccactt |
39800022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #118
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 186 - 273
Target Start/End: Complemental strand, 42553238 - 42553152
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
|||||||||||| |||||||| | | ||||||| |||||||||||| | ||||||| |||||||||||| |||||||||||||| |
|
|
| T |
42553238 |
cccgtgagcatagctcagttgacaacgacatgcattgttatatgcagggtc-ggggttcgaaccccggacactacacttattcacctt |
42553152 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #119
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 187 - 264
Target Start/End: Original strand, 8968750 - 8968827
Alignment:
| Q |
187 |
ccgtgagcatacctcagttggtagggcaat-gcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
|||||||| || |||||||||||||| || |||| |||||||||||| ||||||||| |||||||||||| |||||| |
|
|
| T |
8968750 |
ccgtgagcttagctcagttggtagggatattgcat-attatatgcaggagccggggttcgaaccccggacactccactt |
8968827 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #120
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 199 - 264
Target Start/End: Original strand, 18638611 - 18638676
Alignment:
| Q |
199 |
ctcagttggtagggcaat-gcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
|||||||||||||| || ||||| |||||||||||| ||||||||| |||||||||||| |||||| |
|
|
| T |
18638611 |
ctcagttggtagggatatcgcatt-ttatatgcaggggccggggttcgaaccccggacactccactt |
18638676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #121
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 189 - 270
Target Start/End: Original strand, 30733119 - 30733201
Alignment:
| Q |
189 |
gtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcac |
270 |
Q |
| |
|
||||| ||| ||||||||| |||| ||||| |||||||||||||| | | |||||| ||| |||||||| |||||||||||| |
|
|
| T |
30733119 |
gtgagtatagctcagttggcagggacaatgtattattatatgcagaggtcagggttcgaactccggacactccacttattcac |
30733201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #122
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 215 - 273
Target Start/End: Complemental strand, 37986936 - 37986878
Alignment:
| Q |
215 |
atgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
|||||||||||||||||| | ||| ||| ||||||||||| |||||||||||||||| |
|
|
| T |
37986936 |
atgcattattatatgcagaggtcggagtttgaaccccggacatcccacttattcacctt |
37986878 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #123
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 203 - 277
Target Start/End: Original strand, 39760088 - 39760162
Alignment:
| Q |
203 |
gttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataa |
277 |
Q |
| |
|
||||||||| ||||| |||||||||||||||| || ||| ||||||| ||| |||| ||||||||||||||| |
|
|
| T |
39760088 |
gttggtaggacaatgtattattatatgcaggggttggagtttgaaccccgaacatcccatttattcaccttataa |
39760162 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #124
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 215 - 273
Target Start/End: Complemental strand, 42260789 - 42260731
Alignment:
| Q |
215 |
atgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
||||||| |||||||||||| |||| ||| ||| ||||||| |||||||||||||||| |
|
|
| T |
42260789 |
atgcattgttatatgcagggttcgggtttcgaactccggacatcccacttattcacctt |
42260731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #125
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 214 - 271
Target Start/End: Complemental strand, 2867685 - 2867629
Alignment:
| Q |
214 |
aatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacc |
271 |
Q |
| |
|
||||||||||||||||||||| |||| |||| ||| |||||| |||||||||||||| |
|
|
| T |
2867685 |
aatgcattattatatgcaggg-ccggagttcgaacttcggacatcccacttattcacc |
2867629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #126
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 223 - 264
Target Start/End: Original strand, 3740991 - 3741032
Alignment:
| Q |
223 |
ttatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
|||||||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
3740991 |
ttatatgcaggggtcggggttcgaaccccggacaccccactt |
3741032 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #127
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 213 - 278
Target Start/End: Complemental strand, 4216886 - 4216821
Alignment:
| Q |
213 |
caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||| |||||||||||| || ||| || ||| |||||||||||||||||||||||||| |
|
|
| T |
4216886 |
caatgcattgttatatgcaggggttggagtttgaatcccagacaccccacttattcaccttataag |
4216821 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #128
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 186 - 234
Target Start/End: Original strand, 4793965 - 4794014
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtaggg-caatgcattattatatgcaggg |
234 |
Q |
| |
|
|||||||||||| |||| ||||||||| ||||||||||| |||||||||| |
|
|
| T |
4793965 |
cccgtgagcatagctcaattggtagggacaatgcattataatatgcaggg |
4794014 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #129
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 189 - 277
Target Start/End: Original strand, 7988850 - 7988936
Alignment:
| Q |
189 |
gtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataa |
277 |
Q |
| |
|
||||||||| |||||||||||||| | ||||||||||| |||| | |||||| |||| |||||| ||||||||||||| |||||| |
|
|
| T |
7988850 |
gtgagcatagctcagttggtagggacaaatattattatatgtagggtc--gggttcgaacctcggacatcccacttattcactttataa |
7988936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #130
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 221 - 270
Target Start/End: Complemental strand, 16720641 - 16720592
Alignment:
| Q |
221 |
tattatatgcagggaccggggttctaaccccggacaccccacttattcac |
270 |
Q |
| |
|
|||||||||||||| |||||||| ||| ||||||||||||||| ||||| |
|
|
| T |
16720641 |
tattatatgcaggggtcggggttcaaacaccggacaccccacttcttcac |
16720592 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #131
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 192 - 281
Target Start/End: Complemental strand, 19982340 - 19982251
Alignment:
| Q |
192 |
agcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataagtga |
281 |
Q |
| |
|
|||||| ||| |||| |||| ||||||||||||||||||||| | |||| ||||||| |||||||| ||||| | ||||||||||| |
|
|
| T |
19982340 |
agcatagctcggttgataggataatgcattattatatgcaggggttgaagttcgaaccccgaacaccccatttatttatcttataagtga |
19982251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #132
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 185 - 257
Target Start/End: Original strand, 35515511 - 35515583
Alignment:
| Q |
185 |
tcccgtgagcatacctcagttggtagggcaat-gcattattatatgcagggaccggggttctaaccccggacac |
257 |
Q |
| |
|
|||||||||| || |||||||||||||| || |||| |||||||||||| ||||||||| |||||||||||| |
|
|
| T |
35515511 |
tcccgtgagcttagctcagttggtagggatattgcat-attatatgcaggagccggggttcgaaccccggacac |
35515583 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #133
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 192 - 277
Target Start/End: Complemental strand, 38426852 - 38426768
Alignment:
| Q |
192 |
agcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataa |
277 |
Q |
| |
|
||||||| |||||||||||| |||||||||||||||| |||| | | |||| |||||| |||||| |||||||||| |||||| |
|
|
| T |
38426852 |
agcatacttcagttggtaggataatgcattattatatgtaggg-ctgaggtttgaaccccagacaccttacttattcactttataa |
38426768 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #134
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 185 - 278
Target Start/End: Original strand, 41843654 - 41843747
Alignment:
| Q |
185 |
tcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||| ||| |||| |||||||| |||| |||||||||||||||| | |||||| || || | | |||||||||||||||||||||| |
|
|
| T |
41843654 |
tcccgtgaatatagctcaattggtaggacaatatattattatatgcaggggtcagggttcaaatcctgaaacccccacttattcaccttataag |
41843747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #135
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 199 - 264
Target Start/End: Complemental strand, 3821479 - 3821413
Alignment:
| Q |
199 |
ctcagttggtagggc--aatgcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
|||||||||||||| |||||||| |||||||||||| ||||||||| || |||||| ||||||||| |
|
|
| T |
3821479 |
ctcagttggtagggacaaatgcatt-ttatatgcaggggccggggttcgaatcccggaaaccccactt |
3821413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #136
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 237 - 269
Target Start/End: Complemental strand, 15106934 - 15106902
Alignment:
| Q |
237 |
cggggttctaaccccggacaccccacttattca |
269 |
Q |
| |
|
|||||||| |||||||||||||||||||||||| |
|
|
| T |
15106934 |
cggggttcgaaccccggacaccccacttattca |
15106902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #137
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 180 - 232
Target Start/End: Original strand, 23648321 - 23648372
Alignment:
| Q |
180 |
aaatgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcag |
232 |
Q |
| |
|
|||||| ||||||||||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
23648321 |
aaatgttccgtgagcatagg-cagttggtaggacaatgcattattatatgcag |
23648372 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #138
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 180 - 232
Target Start/End: Complemental strand, 23810251 - 23810200
Alignment:
| Q |
180 |
aaatgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcag |
232 |
Q |
| |
|
|||||| ||||||||||| ||||||||||| |||||||||||||||||||| |
|
|
| T |
23810251 |
aaatgttccgtgagcatagg-cagttggtaggacaatgcattattatatgcag |
23810200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #139
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 226 - 274
Target Start/End: Complemental strand, 24397988 - 24397940
Alignment:
| Q |
226 |
tatgcagggaccggggttctaaccccggacaccccacttattcacctta |
274 |
Q |
| |
|
||||||||| |||||||| ||||||| |||||||||||||||||||| |
|
|
| T |
24397988 |
tatgcagggttcggggttcgaaccccgatcaccccacttattcacctta |
24397940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr5; HSP #140
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 221 - 257
Target Start/End: Complemental strand, 36716893 - 36716857
Alignment:
| Q |
221 |
tattatatgcagggaccggggttctaaccccggacac |
257 |
Q |
| |
|
||||||||||||||||||||||| |||||||||||| |
|
|
| T |
36716893 |
tattatatgcagggaccggggtttgaaccccggacac |
36716857 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 72; Significance: 9e-33; HSPs: 156)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 72; E-Value: 9e-33
Query Start/End: Original strand, 183 - 278
Target Start/End: Complemental strand, 38778780 - 38778685
Alignment:
| Q |
183 |
tgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||||||||| ||||||||||||| |||||||||||||||||||||| ||| ||||||||||||||||| |||||||||| |||||||||| |
|
|
| T |
38778780 |
tgtcccgtgagcatatctcagttggtaggacaatgcattattatatgcaggggccgaggttctaaccccggacatcccacttatttaccttataag |
38778685 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #2
Raw Score: 70; E-Value: 1e-31
Query Start/End: Original strand, 183 - 276
Target Start/End: Complemental strand, 36316075 - 36315982
Alignment:
| Q |
183 |
tgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttata |
276 |
Q |
| |
|
||||||||||||||| ||||||||||||| ||||||||||||||||||||| ||||||||| |||| |||||||||||||||||||||||||| |
|
|
| T |
36316075 |
tgtcccgtgagcatagctcagttggtaggataatgcattattatatgcaggggccggggttcgaacctcggacaccccacttattcaccttata |
36315982 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #3
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 178 - 278
Target Start/End: Original strand, 34948095 - 34948195
Alignment:
| Q |
178 |
acaaatgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataa |
277 |
Q |
| |
|
||||| |||||||||||||| ||||||||||||| ||||||||||| |||||||| | ||| ||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
34948095 |
acaaacgtcccgtgagcatagctcagttggtaggacaatgcattatcatatgcagtggccgaggttcgaaccccggacaccccacttattcaccttataa |
34948194 |
T |
 |
| Q |
278 |
g |
278 |
Q |
| |
|
| |
|
|
| T |
34948195 |
g |
34948195 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #4
Raw Score: 68; E-Value: 2e-30
Query Start/End: Original strand, 183 - 278
Target Start/End: Original strand, 30644163 - 30644258
Alignment:
| Q |
183 |
tgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||||| ||| ||||||||||||| |||||||||||||||||||||| |||| |||| |||||| |||||||||||||||||||||||||| |
|
|
| T |
30644163 |
tgtcccgtgagtatagctcagttggtaggacaatgcattattatatgcaggggccggtgttcgaaccccagacaccccacttattcaccttataag |
30644258 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #5
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 184 - 278
Target Start/End: Complemental strand, 22966058 - 22965964
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||||||| |||| |||||||| |||||||||||||||||||||| ||| ||||| |||||| |||||||||||||||||||||||||| |
|
|
| T |
22966058 |
gtcccgtgagcatagctcaattggtaggacaatgcattattatatgcaggggccgaggttcgaaccccagacaccccacttattcaccttataag |
22965964 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #6
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 188 - 278
Target Start/End: Original strand, 47552212 - 47552302
Alignment:
| Q |
188 |
cgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||| ||||||||||||| ||||||||||||||||||| || ||||||||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
47552212 |
cgtgagcatagctcagttggtaggacaatgcattattatatgcaagggccggggttcgaaccccggacaccctacttattcaccttataag |
47552302 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #7
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 186 - 278
Target Start/End: Complemental strand, 21285452 - 21285359
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||||| ||||||||| |||| ||||||||| |||||||||||| ||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
21285452 |
cccgtgagcatagctcagttggcagggacaatgcattgttatatgcaggggccggggttcgaaccccggacaccccacttattcaccttataag |
21285359 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #8
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 187 - 278
Target Start/End: Complemental strand, 2261581 - 2261490
Alignment:
| Q |
187 |
ccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||||| |||| |||||||| |||||||||||||||||||||| ||||||||| || ||||||||||| |||||||||||||||||| |
|
|
| T |
2261581 |
ccgtgagcatagctcaattggtaggacaatgcattattatatgcaggggccggggttcgaatcccggacacccaacttattcaccttataag |
2261490 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #9
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 190 - 276
Target Start/End: Complemental strand, 27047809 - 27047723
Alignment:
| Q |
190 |
tgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttata |
276 |
Q |
| |
|
|||||||| ||||||||||||| |||||||||||||||||||||| ||||||||| |||| ||||||||||| |||||||||||||| |
|
|
| T |
27047809 |
tgagcatagctcagttggtaggacaatgcattattatatgcaggggccggggttcgaacctcggacaccccatttattcaccttata |
27047723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #10
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 184 - 266
Target Start/End: Complemental strand, 44437925 - 44437843
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttat |
266 |
Q |
| |
|
|||||||||||||| ||||||| ||||| |||||||||||||||||||||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
44437925 |
gtcccgtgagcatagctcagttagtaggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttat |
44437843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #11
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 183 - 271
Target Start/End: Complemental strand, 23685655 - 23685567
Alignment:
| Q |
183 |
tgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacc |
271 |
Q |
| |
|
|||||| |||||||| |||||||| |||| |||||||||||||||||||||| ||||||||| |||||| ||||||||||||||||||| |
|
|
| T |
23685655 |
tgtcccatgagcatagctcagttgataggacaatgcattattatatgcaggggccggggttcgaaccccagacaccccacttattcacc |
23685567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #12
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 183 - 278
Target Start/End: Original strand, 42887148 - 42887243
Alignment:
| Q |
183 |
tgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||||||||| ||||||||||| | |||| ||||||||||||||||| | | ||||| |||||||||||||||||||||| |||||||||| |
|
|
| T |
42887148 |
tgtcccgtgagcatagctcagttggtacgacaattcattattatatgcaggggctgaggttcgaaccccggacaccccacttatttaccttataag |
42887243 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #13
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 180 - 278
Target Start/End: Original strand, 5787452 - 5787550
Alignment:
| Q |
180 |
aaatgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||| ||||||||| ||| |||| |||||||| |||||||||||||||||||||| |||||||| |||||| ||||||||||||||||||||||||| |
|
|
| T |
5787452 |
aaatatcccgtgagtatagctcaattggtaggacaatgcattattatatgcaggggccggggtttgaaccccaaacaccccacttattcaccttataag |
5787550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #14
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 183 - 277
Target Start/End: Complemental strand, 8725238 - 8725145
Alignment:
| Q |
183 |
tgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataa |
277 |
Q |
| |
|
|||| |||||| ||| ||||||||||||| | ||||||||||||||||||| |||||||||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
8725238 |
tgtctcgtgagaatagctcagttggtaggacgatgcattattatatgcagg-accggggttcgaaccccgaacaccccacttattcaccttataa |
8725145 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #15
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 184 - 278
Target Start/End: Complemental strand, 17900979 - 17900885
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||| |||||||| || |||||||||| |||||||||||||||||||||| |||||| || |||||||||| |||||||||||| ||||||||| |
|
|
| T |
17900979 |
gtcccatgagcatagcttagttggtaggacaatgcattattatatgcaggggccggggctcgaaccccggactccccacttattctccttataag |
17900885 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #16
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 184 - 278
Target Start/End: Complemental strand, 22706128 - 22706034
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||| |||| ||||||||||||| ||||| |||||||||||||||| | | ||||| ||| ||||||||||||||||||||||||||||| |
|
|
| T |
22706128 |
gtcccgtgaacatagctcagttggtaggacaatgtattattatatgcaggggctgaggttcaaactccggacaccccacttattcaccttataag |
22706034 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #17
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 184 - 277
Target Start/End: Complemental strand, 46337968 - 46337874
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggaca-ccccacttattcaccttataa |
277 |
Q |
| |
|
||||||||| |||| |||||||||||| ||||||||||||||||||||||| |||||||| ||||| ||||| ||||||||||||||||||||| |
|
|
| T |
46337968 |
gtcccgtgaacatagttcagttggtaggacaatgcattattatatgcagggatcggggttcgaaccctggacacccccacttattcaccttataa |
46337874 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #18
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 186 - 278
Target Start/End: Complemental strand, 29658371 - 29658278
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||||| |||| |||| || | ||||||||| |||||||||||| ||||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
29658371 |
cccgtgagcatagctcaattggcagcgacaatgcattgttatatgcaggggccggggttcgaaccccggacaccccacttattcaccttataag |
29658278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #19
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 181 - 277
Target Start/End: Complemental strand, 25711234 - 25711138
Alignment:
| Q |
181 |
aatgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataa |
277 |
Q |
| |
|
||||||||||||| ||| |||||||| |||| |||||||||||||||| |||| ||||||||| |||| |||||||||||||||||||| |||||| |
|
|
| T |
25711234 |
aatgtcccgtgagtataactcagttgataggataatgcattattatatgtaggggccggggttcgaacctcggacaccccacttattcactttataa |
25711138 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #20
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 183 - 278
Target Start/End: Original strand, 2366351 - 2366446
Alignment:
| Q |
183 |
tgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||||| ||| |||||||| |||| |||||||||||||||||||||| |||||||| ||| | |||||||||||||||||||||||||| |
|
|
| T |
2366351 |
tgtcccgtgagtataactcagttgataggacaatgcattattatatgcaggggtcggggttcgaactctagacaccccacttattcaccttataag |
2366446 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #21
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 184 - 278
Target Start/End: Original strand, 21086099 - 21086193
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||| ||| |||| ||||||||||||| ||||||||||||||||||||||| || |||| ||| |||||||||| |||||||||||||||||| |
|
|
| T |
21086099 |
gtcccatgaacatagctcagttggtaggacaatgcattattatatgcagggatcgaagttcgaactccggacacccaacttattcaccttataag |
21086193 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #22
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 184 - 278
Target Start/End: Original strand, 25818281 - 25818375
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||||||| ||||||||||||| ||||||||||||||||||||| | || |||| ||||||| |||| ||||||||||||| |||||| |
|
|
| T |
25818281 |
gtcccgtgagcataactcagttggtaggataatgcattattatatgcaggggctggagttcgaaccccgaacactccacttattcaccatataag |
25818375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #23
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 188 - 278
Target Start/End: Original strand, 30152740 - 30152830
Alignment:
| Q |
188 |
cgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||| || ||||||||||||| |||||||||||||||| |||| |||||||| ||||||| ||||||||||||||||||||||||| |
|
|
| T |
30152740 |
cgtgagcttagctcagttggtaggacaatgcattattatatataggggtcggggttcgaaccccgaacaccccacttattcaccttataag |
30152830 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #24
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 184 - 278
Target Start/End: Complemental strand, 45198198 - 45198104
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||||||| ||||||||||||| ||||||||||||||||||| || | | ||| |||||||||||||||| |||||||||||||||| |
|
|
| T |
45198198 |
gtcccgtgagcataactcagttggtaggataatgcattattatatgcagtgattgagattcgaaccccggacaccccatttattcaccttataag |
45198104 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #25
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 185 - 274
Target Start/End: Original strand, 11808034 - 11808123
Alignment:
| Q |
185 |
tcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctta |
274 |
Q |
| |
|
|||||||||| || |||| ||||||||| ||||||| |||||||||||| |||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
11808034 |
tcccgtgagcttagctcaattggtagggacatgcattgttatatgcaggggtcggggttcgaaccccggacaccccacttattcacctta |
11808123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #26
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 185 - 281
Target Start/End: Complemental strand, 31475940 - 31475843
Alignment:
| Q |
185 |
tcccgtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataagtga |
281 |
Q |
| |
|
||||||||||||| ||||||||| |||| || ||||||||||||||||||| | ||||||| |||||| |||||||||||||||||| ||| |||||| |
|
|
| T |
31475940 |
tcccgtgagcatagctcagttggcagggacattgcattattatatgcaggggctggggttcgaacccctgacaccccacttattcactttaaaagtga |
31475843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #27
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 186 - 277
Target Start/End: Original strand, 4169072 - 4169164
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataa |
277 |
Q |
| |
|
|||||||||||| ||||||||| |||| ||||| ||| ||||||||| || |||||||| |||||||||||||||||||||||||||||||| |
|
|
| T |
4169072 |
cccgtgagcatagctcagttggcagggacaatgtattgttatatgcaagggccggggtttgaaccccggacaccccacttattcaccttataa |
4169164 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #28
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 185 - 265
Target Start/End: Original strand, 7465462 - 7465542
Alignment:
| Q |
185 |
tcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccactta |
265 |
Q |
| |
|
||||||||||||| ||||||||| || | |||||||||||||||||||| ||||||||| |||||||||||||||||||| |
|
|
| T |
7465462 |
tcccgtgagcatagctcagttggcagagacatgcattattatatgcaggggccggggttcgaaccccggacaccccactta |
7465542 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #29
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 190 - 278
Target Start/End: Original strand, 46716334 - 46716422
Alignment:
| Q |
190 |
tgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||| ||||||||||||| |||||||||||||||||||| | |||||||| ||||| | |||||||||||||| |||||||||| |
|
|
| T |
46716334 |
tgagcatagctcagttggtaggacaatgcattattatatgcagaggtcggggttcgaaccctgaacaccccacttatttaccttataag |
46716422 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #30
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 186 - 273
Target Start/End: Original strand, 1649149 - 1649236
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
|||||||||||| |||||||||||||| ||||||| || ||||||||| || |||||| ||||| |||||||||||||||||||||| |
|
|
| T |
1649149 |
cccgtgagcatagctcagttggtagggatatgcattgttttatgcaggggccagggttcgaaccctggacaccccacttattcacctt |
1649236 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #31
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 215 - 278
Target Start/End: Original strand, 14102487 - 14102550
Alignment:
| Q |
215 |
atgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
14102487 |
atgcattattatatgcaggggccggggtttgaaccccggacaccccacttattcaccttataag |
14102550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #32
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 215 - 278
Target Start/End: Original strand, 14412504 - 14412567
Alignment:
| Q |
215 |
atgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||||||||||||| |||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
14412504 |
atgcattattatatgcaggggccggggtttgaaccccggacaccccacttattcaccttataag |
14412567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #33
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 186 - 273
Target Start/End: Original strand, 35195840 - 35195927
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
||||| |||||| ||||||||| |||| |||||||||||||||||||| ||||||||| ||||||| |||||||| ||||||||||| |
|
|
| T |
35195840 |
cccgtaagcatagctcagttggcagggacatgcattattatatgcaggggccggggttcgaaccccgaacaccccatttattcacctt |
35195927 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #34
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 187 - 269
Target Start/End: Original strand, 32814825 - 32814907
Alignment:
| Q |
187 |
ccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattca |
269 |
Q |
| |
|
||||||||||| |||||||||||||| |||||||||||||||||||| ||| |||| || ||||||||||||||||||||| |
|
|
| T |
32814825 |
ccgtgagcatagctcagttggtagggacatgcattattatatgcaggggtcggagttcgaatcccggacaccccacttattca |
32814907 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #35
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 189 - 278
Target Start/End: Original strand, 38451862 - 38451952
Alignment:
| Q |
189 |
gtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||| |||||||| |||| ||||||||| |||||||||||| ||||||||| || |||||||||||||||||||||| ||||||| |
|
|
| T |
38451862 |
gtgagcatagctcagttgacagggacaatgcattgttatatgcaggggccggggttcgaatcccggacaccccacttattcacattataag |
38451952 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #36
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 186 - 281
Target Start/End: Complemental strand, 14818464 - 14818368
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataagtga |
281 |
Q |
| |
|
|||||||||||| ||||||||| |||| || ||||||||||||||||||| |||||||| |||||| ||||||||||||||||| ||| |||||| |
|
|
| T |
14818464 |
cccgtgagcatagctcagttggcagggacagtgcattattatatgcaggggtcggggttcaaaccccaaacaccccacttattcactttaaaagtga |
14818368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #37
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 186 - 281
Target Start/End: Complemental strand, 15265462 - 15265366
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataagtga |
281 |
Q |
| |
|
|||||||||||| ||||||||| |||| || ||||||||||||||||||| |||||||| |||||| ||||||||||||||||| ||| |||||| |
|
|
| T |
15265462 |
cccgtgagcatagctcagttggcagggacagtgcattattatatgcaggggtcggggttcaaaccccaaacaccccacttattcactttaaaagtga |
15265366 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #38
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 184 - 278
Target Start/End: Complemental strand, 27907993 - 27907902
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||||| ||||||||||||| |||||||||||||||||||||| ||||||| || | ||||||||||||||||||| |||||||| |
|
|
| T |
27907993 |
gtcccgtgagca---ctcagttggtaggacaatgcattattatatgcaggggccggggtaagaatctcggacaccccacttattcatcttataag |
27907902 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #39
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 186 - 281
Target Start/End: Original strand, 41139083 - 41139179
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataagtga |
281 |
Q |
| |
|
|||||||||||| ||||||||| |||| |||||||||||||||||||||| |||||||| || ||||||||| ||||||||||| ||| |||||| |
|
|
| T |
41139083 |
cccgtgagcatagctcagttggcagggacaatgcattattatatgcaggggtcggggttcgaatcccggacacttcacttattcactttaaaagtga |
41139179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #40
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 202 - 278
Target Start/End: Complemental strand, 45011740 - 45011664
Alignment:
| Q |
202 |
agttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||| |||||||||||||||||||| | || |||||| |||| |||| ||||||||||||||||||||||| |
|
|
| T |
45011740 |
agttggtaggacaatgcattattatatgcagaggccagggttcgaacctcggagaccccacttattcaccttataag |
45011664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #41
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 183 - 254
Target Start/End: Original strand, 8195909 - 8195980
Alignment:
| Q |
183 |
tgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccgga |
254 |
Q |
| |
|
||||||||||||||| ||||||||||||| |||||||||||||||| ||||| ||||||||| || |||||| |
|
|
| T |
8195909 |
tgtcccgtgagcatagctcagttggtaggacaatgcattattatatccaggggccggggttcgaagcccgga |
8195980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #42
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 182 - 277
Target Start/End: Original strand, 4104473 - 4104570
Alignment:
| Q |
182 |
atgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggacc--ggggttctaaccccggacaccccacttattcaccttataa |
277 |
Q |
| |
|
|||||||||||||||| |||| ||| |||| ||||||||||||||||||| || | ||||||| || |||||||||| |||||||||||||||||| |
|
|
| T |
4104473 |
atgtcccgtgagcatagctcaattgttaggacaatgcattattatatgcaagggtcggggggttcgaatcccggacacctcacttattcaccttataa |
4104570 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #43
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 183 - 269
Target Start/End: Original strand, 30741558 - 30741643
Alignment:
| Q |
183 |
tgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattca |
269 |
Q |
| |
|
||||||||||||||| ||||||||||||| |||| ||| |||||||||||| |||| |||| ||||||||||| |||||||||||| |
|
|
| T |
30741558 |
tgtcccgtgagcataactcagttggtaggataatgtattgttatatgcaggggccggtgttcgaaccccggaca-cccacttattca |
30741643 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #44
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 183 - 273
Target Start/End: Original strand, 49012392 - 49012482
Alignment:
| Q |
183 |
tgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
||||||||||||||| ||||||||||||| ||||||||||||||||| |||| | |||||| || || ||||||| ||||||||||||| |
|
|
| T |
49012392 |
tgtcccgtgagcatagctcagttggtaggacaatgcattattatatgaaggggtcagggttcaaattccagacaccctacttattcacctt |
49012482 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #45
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 193 - 281
Target Start/End: Original strand, 19126740 - 19126829
Alignment:
| Q |
193 |
gcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataagtga |
281 |
Q |
| |
|
||||| ||||||||||||| |||||||||||||||| ||||| | | ||||| ||||||||||||||||||||||||| ||| |||||| |
|
|
| T |
19126740 |
gcatagctcagttggtaggaacaatgcattattatatacaggggctgaggttcgaaccccggacaccccacttattcactttaaaagtga |
19126829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #46
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 186 - 278
Target Start/End: Complemental strand, 33202653 - 33202560
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||| |||| ||||||||| |||| || || ||| |||||| ||||| ||||||||| |||||||||||||||||||||||| |||||||| |
|
|
| T |
33202653 |
cccgtgaacataactcagttggcagggacattgtattgttatatacaggggccggggttcgaaccccggacaccccacttattcatcttataag |
33202560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #47
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 189 - 281
Target Start/End: Original strand, 24396945 - 24397037
Alignment:
| Q |
189 |
gtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataagtga |
281 |
Q |
| |
|
|||||||| ||||||||| ||| |||||||||||||||||||||| ||| |||| ||||| |||||||| |||||||||| ||| |||||| |
|
|
| T |
24396945 |
gtgagcatgtctcagttggcaggacaatgcattattatatgcaggggtcggagttcgaaccctggacaccctacttattcactttaaaagtga |
24397037 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #48
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 184 - 272
Target Start/End: Complemental strand, 34962072 - 34961984
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacct |
272 |
Q |
| |
|
|||| ||||||||| ||||||||||||| |||||||||||||||||||| | ||| ||| ||||| ||||| ||||||||||||||| |
|
|
| T |
34962072 |
gtcctgtgagcatagctcagttggtaggacaatgcattattatatgcagtagctgggattcgaaccctggacatcccacttattcacct |
34961984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #49
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 186 - 281
Target Start/End: Complemental strand, 41417374 - 41417278
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataagtga |
281 |
Q |
| |
|
|||||||||||| ||||||||| ||| || ||||| ||||||||||||| |||||||| |||||| |||||||||||||||||| ||| |||||| |
|
|
| T |
41417374 |
cccgtgagcatagctcagttggcaggaacagtgcatcattatatgcaggggtcggggttcgaaccccagacaccccacttattcactttaaaagtga |
41417278 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #50
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 186 - 274
Target Start/End: Original strand, 43635585 - 43635673
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctta |
274 |
Q |
| |
|
|||||||||||| ||||||||| || ||||||| |||||||||| | |||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
43635585 |
cccgtgagcataactcagttggcagaaacatgcattgttatatgcagcggtcggggttcgaaccccggacaccccacttattcacctta |
43635673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #51
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 190 - 277
Target Start/End: Original strand, 24479584 - 24479670
Alignment:
| Q |
190 |
tgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataa |
277 |
Q |
| |
|
|||||||| |||| |||||||| || |||||||||||||| |||| | ||||||| ||||||||||| ||||||||||||||| |||| |
|
|
| T |
24479584 |
tgagcatagctcaattggtaggacagtgcattattatatggaggggctggggttcgaaccccggaca-cccacttattcacctcataa |
24479670 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #52
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 186 - 273
Target Start/End: Original strand, 48174964 - 48175051
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
|||||||| ||| ||||||||| | || |||||||||||||| ||||| |||| |||| ||||||||||||||||||||||| |||| |
|
|
| T |
48174964 |
cccgtgagtatagctcagttggcaaggacatgcattattatatacaggggccggtgttcgaaccccggacaccccacttattcccctt |
48175051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #53
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 184 - 278
Target Start/End: Complemental strand, 25087050 - 25086956
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||||||| | |||| ||||| |||||||||||||||| |||||||||| ||| |||| | ||||| ||||||||||||||||||| |
|
|
| T |
25087050 |
gtcccgtgagcatagtttagttcgtaggacaatgcattattatatatagggaccgggattcgaacctcaaacacctcacttattcaccttataag |
25086956 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #54
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 184 - 278
Target Start/End: Original strand, 29778976 - 29779070
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||||||| |||| |||||||| ||||||||||||||||||||| ||| |||| ||| ||| | || ||||||||||||||||||| |
|
|
| T |
29778976 |
gtcccgtgagcatagctcaattggtaggataatgcattattatatgcaggggtcggagttcgaactccgaatacttcacttattcaccttataag |
29779070 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #55
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 184 - 278
Target Start/End: Original strand, 31694066 - 31694159
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||| |||| |||||||||| || |||||||||||||||||||||| || | ||| ||| |||||||||||||||||| || ||||||| |
|
|
| T |
31694066 |
gtcccgtgaacatagctcagttggt-ggacaatgcattattatatgcaggggacgagattcgaactccggacaccccacttatttactttataag |
31694159 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #56
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 184 - 267
Target Start/End: Complemental strand, 32387225 - 32387140
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccgggg--ttctaaccccggacaccccacttatt |
267 |
Q |
| |
|
|||||||||||||| ||||||||||||| ||| |||||||||||| |||| |||||| ||| ||||||| |||||||||||||| |
|
|
| T |
32387225 |
gtcccgtgagcataactcagttggtaggataatacattattatatgtaggggccggggttttcgaaccccgaacaccccacttatt |
32387140 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #57
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 200 - 278
Target Start/End: Original strand, 38792223 - 38792301
Alignment:
| Q |
200 |
tcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||| | |||||||||||||||||||||| | | ||| |||||||||||||| |||||||||||||||||| |
|
|
| T |
38792223 |
tcagttggtaagacaatgcattattatatgcaggggtcagagtttgaaccccggacaccctacttattcaccttataag |
38792301 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #58
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 184 - 278
Target Start/End: Complemental strand, 43970953 - 43970860
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||||||| |||||||||||| |||||||||||||||||||| |||||||| |||| || ||| || |||||||||||||||||| |
|
|
| T |
43970953 |
gtcccgtgagcataactcagttggtagaacaatgcattattatatgcagaagacggggttcgaacctcgaaca-cctacttattcaccttataag |
43970860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #59
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 193 - 278
Target Start/End: Complemental strand, 924383 - 924298
Alignment:
| Q |
193 |
gcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||| ||||||||||||| | |||||||||||||| |||| ||||||| |||||| |||||||||||||||| ||||||||| |
|
|
| T |
924383 |
gcatagctcagttggtaggatagtgcattattatatgtaggggttggggttcgaaccccagacaccccacttattcgccttataag |
924298 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #60
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 184 - 278
Target Start/End: Original strand, 22741198 - 22741294
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcag--ggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||||||| ||| ||||||||| |||||||||||||||||||| | ||||||| || | ||||||||||||||||||| |||||||| |
|
|
| T |
22741198 |
gtcccgtgagcatagctcggttggtaggacaatgcattattatatgcagtagtcagggggttcgaatctcggacaccccacttattcatcttataag |
22741294 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #61
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 182 - 278
Target Start/End: Complemental strand, 7263100 - 7263004
Alignment:
| Q |
182 |
atgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||||| ||| ||||||||||||| ||||||||||||||||| || | || |||| ||||||| |||||| | ||||||| |||||||| |
|
|
| T |
7263100 |
atgtcccgtgagtatagctcagttggtaggacaatgcattattatatgtagaggttggagttcgaaccccgaacaccctatttattcatcttataag |
7263004 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #62
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 190 - 278
Target Start/End: Original strand, 35368397 - 35368485
Alignment:
| Q |
190 |
tgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||| ||| ||||||||||||| || ||||||||||||| |||| | | ||||| ||| |||||||||||| |||||||||||||||| |
|
|
| T |
35368397 |
tgagaataactcagttggtaggacattgcattattatatttaggggctgtggttcgaactccggacaccccatttattcaccttataag |
35368485 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #63
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 221 - 273
Target Start/End: Original strand, 37665776 - 37665828
Alignment:
| Q |
221 |
tattatatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||||||||||||||||||| |||| |
|
|
| T |
37665776 |
tattatatgcaggggccggggttcaaaccccggacaccccacttattcgcctt |
37665828 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #64
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 218 - 270
Target Start/End: Original strand, 47880175 - 47880227
Alignment:
| Q |
218 |
cattattatatgcagggaccggggttctaaccccggacaccccacttattcac |
270 |
Q |
| |
|
||||||||||||||||| ||||||||| || |||||||||||||||||||||| |
|
|
| T |
47880175 |
cattattatatgcaggggccggggttcgaatcccggacaccccacttattcac |
47880227 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #65
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 189 - 278
Target Start/End: Complemental strand, 4590701 - 4590619
Alignment:
| Q |
189 |
gtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||| ||||||||||||| ||||||||||||||||||| |||||| || |||||||||| |||||||||| |||||||| |
|
|
| T |
4590701 |
gtgagcatagctcagttggtaggacaatgcattattatatgca-------gggttcgaatcccggacaccacacttattcatcttataag |
4590619 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #66
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 186 - 264
Target Start/End: Complemental strand, 9877337 - 9877259
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaat-gcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||||||| || |||||||||||||| || |||| ||||||||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
9877337 |
cccgtgagcttagctcagttggtagggatattgcat-attatatgcaggggccggggttcgaaccccggacaccccactt |
9877259 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #67
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 184 - 278
Target Start/End: Complemental strand, 14967734 - 14967639
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccac-ttattcaccttataag |
278 |
Q |
| |
|
|||| ||||||||| ||||||||||||| ||||||||||||||||| |||| ||||||| |||| | |||||| ||| ||||||| |||||||| |
|
|
| T |
14967734 |
gtcctgtgagcataactcagttggtaggacaatgcattattatatgtaggggtcggggtttgaacctcagacacctcactttattcaacttataag |
14967639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #68
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 184 - 278
Target Start/End: Complemental strand, 15397210 - 15397115
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccac-ttattcaccttataag |
278 |
Q |
| |
|
|||| ||||||||| ||||||||||||| ||||||||||||||||| |||| ||||||| |||| | |||||| ||| ||||||| |||||||| |
|
|
| T |
15397210 |
gtcctgtgagcataactcagttggtaggacaatgcattattatatgtaggggtcggggtttgaacctcagacacctcactttattcaacttataag |
15397115 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #69
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 186 - 264
Target Start/End: Complemental strand, 23102628 - 23102550
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaat-gcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||||||| || |||||||||||||| || |||| ||||||||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
23102628 |
cccgtgagcttagctcagttggtagggatattgcat-attatatgcaggggccggggttcgaaccccggacaccccactt |
23102550 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #70
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 215 - 273
Target Start/End: Complemental strand, 2567901 - 2567843
Alignment:
| Q |
215 |
atgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
||||||| |||||||||||| ||||||||| |||||||| ||||||||||||| ||||| |
|
|
| T |
2567901 |
atgcatttttatatgcaggggccggggttcgaaccccggtcaccccacttattaacctt |
2567843 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #71
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 184 - 265
Target Start/End: Original strand, 4818015 - 4818097
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgc-agggaccggggttctaaccccggacaccccactta |
265 |
Q |
| |
|
||||||||||||| ||||||||||||| |||||||||||||||||| ||| ||| ||||| ||| || ||||||||||||| |
|
|
| T |
4818015 |
gtcccgtgagcatcgctcagttggtaggacaatgcattattatatgcggggggccgtggttcgaactccagacaccccactta |
4818097 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #72
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 200 - 278
Target Start/End: Original strand, 8724391 - 8724469
Alignment:
| Q |
200 |
tcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||||| ||| ||||||||||||||| | |||| || |||| |||||||||||||||||||||||||||| |
|
|
| T |
8724391 |
tcagttggtaggataatacattattatatgcagaggtcgggaatcgaacctcggacaccccacttattcaccttataag |
8724469 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #73
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 188 - 274
Target Start/End: Complemental strand, 10474608 - 10474522
Alignment:
| Q |
188 |
cgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctta |
274 |
Q |
| |
|
|||||||||| ||||||||||| | || |||| |||||||||||| |||||||| | ||||||||||| ||||||||||||||| |
|
|
| T |
10474608 |
cgtgagcatagttcagttggtagagacatacattgttatatgcaggggtcggggttcgacccccggacacctcacttattcacctta |
10474522 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #74
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 184 - 270
Target Start/End: Complemental strand, 13905526 - 13905440
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcac |
270 |
Q |
| |
|
||||||||| |||| ||||||||||||| ||||| ||||||||| ||||| |||| |||| ||||| |||||| ||||||||||| |
|
|
| T |
13905526 |
gtcccgtgaacatagctcagttggtaggacaatgtattattataaacaggggccggagttcgaaccctagacaccacacttattcac |
13905440 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #75
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 189 - 270
Target Start/End: Complemental strand, 20527525 - 20527443
Alignment:
| Q |
189 |
gtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcac |
270 |
Q |
| |
|
||||| ||| ||||||||| |||| ||||||||| |||||||||||| |||| |||| ||||||| ||||| ||||||||||| |
|
|
| T |
20527525 |
gtgagtatagctcagttggcagggacaatgcattgttatatgcaggggccggagttcgaaccccgaacacctcacttattcac |
20527443 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #76
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 184 - 278
Target Start/End: Original strand, 21925470 - 21925564
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||||||| |||| |||||||| |||||||||||||||| || | ||||||| ||| |||| | ||||||||||||||||||||| |
|
|
| T |
21925470 |
gtcccgtgagcatagctcaattggtaggacaatgcattattatatacataggtcggggtttgaacttcggatatcccacttattcaccttataag |
21925564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #77
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 184 - 278
Target Start/End: Complemental strand, 29710200 - 29710107
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||| ||| ||||||||||||| ||||||||||||||||| |||| | | ||||| ||| | ||||| ||||||||||| |||||||| |
|
|
| T |
29710200 |
gtcccgtgagtatagctcagttggtaggacaatgcattattatatgtaggg-ctgaggttcgaactctagacactccacttattcatcttataag |
29710107 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #78
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 194 - 268
Target Start/End: Original strand, 36176876 - 36176950
Alignment:
| Q |
194 |
catacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattc |
268 |
Q |
| |
|
|||| ||||||||||||| ||||||||||||||||| |||| | ||||| ||||||||||||| ||||||||| |
|
|
| T |
36176876 |
catagctcagttggtaggacaatgcattattatatgtaggggctaaggttcaaaccccggacacctcacttattc |
36176950 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #79
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 184 - 278
Target Start/End: Original strand, 38025336 - 38025430
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||| ||||||||| |||| ||| |||| ||||||||||||||||||||| ||||||| |||| |||||| ||||||||||| |||||||| |
|
|
| T |
38025336 |
gtcctgtgagcatagctcatttgataggacaatgcattattatatgcaggagttggggttcgaacctcggacattccacttattcatcttataag |
38025430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #80
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 186 - 264
Target Start/End: Complemental strand, 38032953 - 38032875
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||||| |||| ||||||||| |||| ||||||| |||||| ||||| ||||||||| ||||||||||||| ||||| |
|
|
| T |
38032953 |
cccgtgaacataactcagttggcagggacatgcattgttatatacaggggccggggttcgaaccccggacacctcactt |
38032875 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #81
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 180 - 264
Target Start/End: Complemental strand, 41833057 - 41832976
Alignment:
| Q |
180 |
aaatgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
|||||| || |||||||| ||||||||||||| ||||| ||||| |||||||| ||||||||| ||||| ||||||||||||| |
|
|
| T |
41833057 |
aaatgttccatgagcataactcagttggtaggacaatgaattat---atgcaggggccggggttcgaaccctggacaccccactt |
41832976 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #82
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 189 - 234
Target Start/End: Original strand, 22047520 - 22047565
Alignment:
| Q |
189 |
gtgagcatacctcagttggtagggcaatgcattattatatgcaggg |
234 |
Q |
| |
|
||||||||| ||||||||||||| |||||||||||||||||||||| |
|
|
| T |
22047520 |
gtgagcatagctcagttggtaggacaatgcattattatatgcaggg |
22047565 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #83
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 185 - 277
Target Start/End: Original strand, 22660736 - 22660829
Alignment:
| Q |
185 |
tcccgtgagcatacctcagttggtagggc-aatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataa |
277 |
Q |
| |
|
||||||||||||| ||||||| |||| |||||||| ||||||| |||| ||||||||| |||||| |||||||||||||| ||||||||| |
|
|
| T |
22660736 |
tcccgtgagcatagttcagttgacagggataatgcattgttatatgtaggggccggggttcgaaccccaaacaccccacttatttaccttataa |
22660829 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #84
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 189 - 274
Target Start/End: Complemental strand, 41012676 - 41012591
Alignment:
| Q |
189 |
gtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctta |
274 |
Q |
| |
|
||||||||| |||| ||||||||| ||||||| ||||||| |||| |||| | || ||||||| ||| ||||||||||||||||| |
|
|
| T |
41012676 |
gtgagcatagctcaattggtagggacatgcattgttatatgtaggggccggagctcgaaccccgaacatcccacttattcacctta |
41012591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #85
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 221 - 273
Target Start/End: Original strand, 23602306 - 23602358
Alignment:
| Q |
221 |
tattatatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
|||||||||||| |||||| |||| ||||||||||||| |||||||||||||| |
|
|
| T |
23602306 |
tattatatgcagtgaccggagttcgaaccccggacacctcacttattcacctt |
23602358 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #86
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 206 - 278
Target Start/End: Complemental strand, 27957675 - 27957604
Alignment:
| Q |
206 |
ggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||| ||||| ||||||||||||| || ||||||||| || ||||||||||| ||||||||||||||||| |
|
|
| T |
27957675 |
ggtaggacaatgtattattatatgcaagggccggggttcgaaatccggacacccc-cttattcaccttataag |
27957604 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #87
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 186 - 270
Target Start/End: Original strand, 37917389 - 37917473
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcac |
270 |
Q |
| |
|
|||||||||||| ||||||||||||| |||||| ||||||||||||| ||||||| ||||| ||||||||||||||||| |
|
|
| T |
37917389 |
cccgtgagcatagctcagttggtaggaacatgcataattatatgcaggggttggggttcaaaccctaaacaccccacttattcac |
37917473 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #88
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 190 - 266
Target Start/End: Complemental strand, 43712407 - 43712331
Alignment:
| Q |
190 |
tgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttat |
266 |
Q |
| |
|
|||||||| |||||||||||||| ||||||| |||||| ||||| |||||||| |||| |||| ||||||||||| |
|
|
| T |
43712407 |
tgagcataactcagttggtagggacatgcattgttatatacaggggtcggggttcgaacctcggataccccacttat |
43712331 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #89
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 189 - 273
Target Start/End: Original strand, 44409201 - 44409284
Alignment:
| Q |
189 |
gtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
||||||||| ||||||| | |||| ||||||||||||||||| || |||||||| || |||| |||||||||||||||||||| |
|
|
| T |
44409201 |
gtgagcataactcagttagcagggacatgcattattatatgcaagggtcggggttcgaa-cccgaacaccccacttattcacctt |
44409284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #90
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 221 - 264
Target Start/End: Complemental strand, 1563774 - 1563731
Alignment:
| Q |
221 |
tattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
1563774 |
tattatatgcaggggccggggttcgaaccccggacaccccactt |
1563731 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #91
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 199 - 263
Target Start/End: Original strand, 13702037 - 13702102
Alignment:
| Q |
199 |
ctcagttggtagggc--aatgcattattatatgcagggaccggggttctaaccccggacaccccact |
263 |
Q |
| |
|
|||||||||||||| |||||||| |||||||||||| ||||||||| |||||||||||||||||| |
|
|
| T |
13702037 |
ctcagttggtagggacaaatgcatt-ttatatgcaggggccggggttcaaaccccggacaccccact |
13702102 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #92
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 186 - 264
Target Start/End: Original strand, 15238889 - 15238967
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaat-gcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||||||| || |||||||||||||| || |||| ||||||||||||| ||||||||| |||||||||||| |||||| |
|
|
| T |
15238889 |
cccgtgagcttagctcagttggtagggatattgcat-attatatgcaggggccggggttcgaaccccggacactccactt |
15238967 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #93
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 226 - 273
Target Start/End: Original strand, 20529933 - 20529980
Alignment:
| Q |
226 |
tatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
|||||||||| |||||||| | |||||||||||||||||||||||||| |
|
|
| T |
20529933 |
tatgcagggatcggggttcaagccccggacaccccacttattcacctt |
20529980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #94
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 183 - 270
Target Start/End: Original strand, 35498392 - 35498478
Alignment:
| Q |
183 |
tgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcac |
270 |
Q |
| |
|
|||||||| |||||| ||||||||| |||| |||||||||||||||||||| |||||| ||| |||||||||||||||||||| |
|
|
| T |
35498392 |
tgtcccgtaagcataactcagttggcagggacatgcattattatatgcaggg-gttgggttcaaacttcggacaccccacttattcac |
35498478 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #95
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 187 - 274
Target Start/End: Complemental strand, 37410578 - 37410491
Alignment:
| Q |
187 |
ccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctta |
274 |
Q |
| |
|
||||||||||| ||||||||||| || ||||||| |||||||||||| | ||||| ||| ||||||||| ||||||||| ||||| |
|
|
| T |
37410578 |
ccgtgagcatagctcagttggtaaggacatgcattgttatatgcaggggtcaaggttcgaactccggacacctcacttattctcctta |
37410491 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #96
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 199 - 263
Target Start/End: Original strand, 46645721 - 46645786
Alignment:
| Q |
199 |
ctcagttggtagggc--aatgcattattatatgcagggaccggggttctaaccccggacaccccact |
263 |
Q |
| |
|
|||||||||||||| |||||||| |||||||||||| ||||||||| |||||||||||||||||| |
|
|
| T |
46645721 |
ctcagttggtagggacaaatgcatt-ttatatgcaggggccggggttcgaaccccggacaccccact |
46645786 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #97
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 184 - 278
Target Start/End: Original strand, 7908705 - 7908798
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||| |||| |||| | ||||||||||| || ||||||||||||||||| | | | ||||| |||||| |||||| |||||||||||||||||| |
|
|
| T |
7908705 |
gtcctgtgaacatagcacagttggtaggaca-tgcattattatatgcagaggctgaggttcgaaccccaaacaccctacttattcaccttataag |
7908798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #98
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 187 - 264
Target Start/End: Complemental strand, 9712267 - 9712190
Alignment:
| Q |
187 |
ccgtgagcatacctcagttggtagggcaat-gcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
|||||||| || |||||||||||||| || |||| ||||||||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
9712267 |
ccgtgagcttaactcagttggtagggatattgcat-attatatgcaggggtcggggttcgaaccccggacaccccactt |
9712190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #99
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 223 - 273
Target Start/End: Original strand, 14707326 - 14707376
Alignment:
| Q |
223 |
ttatatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
|||||||||||| ||||||| |||||||||||||||||||||||||||| |
|
|
| T |
14707326 |
ttatatgcaggggttggggttcgaaccccggacaccccacttattcacctt |
14707376 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #100
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 187 - 264
Target Start/End: Original strand, 24188471 - 24188548
Alignment:
| Q |
187 |
ccgtgagcatacctcagttggtagggcaa-tgcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||||||||| |||||||||||||| | ||||| ||||||||||||| |||||||| |||||| |||||||||||| |
|
|
| T |
24188471 |
ccgtgagcatagctcagttggtagggatactgcat-attatatgcaggggtcggggttcgaaccccagacaccccactt |
24188548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #101
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 213 - 279
Target Start/End: Complemental strand, 24304354 - 24304288
Alignment:
| Q |
213 |
caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataagt |
279 |
Q |
| |
|
|||||||||||||||||||||| |||||||| ||| ||| |||||||| |||||||| ||| |||| |
|
|
| T |
24304354 |
caatgcattattatatgcaggggtcggggttcgaactccgaacaccccatttattcactttaaaagt |
24304288 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #102
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 186 - 268
Target Start/End: Complemental strand, 27726467 - 27726385
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattc |
268 |
Q |
| |
|
||||||| |||| ||||||||| |||| ||||||||||||| |||| | ||||||||| |||| ||||||||| ||||||| |
|
|
| T |
27726467 |
cccgtgaacatagctcagttggcagggacatgcattattataagcagtggccggggttcgaacctcggacaccctgcttattc |
27726385 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #103
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 221 - 270
Target Start/End: Complemental strand, 28914941 - 28914891
Alignment:
| Q |
221 |
tattatatgcaggga-ccggggttctaaccccggacaccccacttattcac |
270 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||||||||||||||||||||| |
|
|
| T |
28914941 |
tattatatgcagggggccggggttcgaaccccggacaccccacttattcac |
28914891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #104
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 213 - 267
Target Start/End: Complemental strand, 34960991 - 34960937
Alignment:
| Q |
213 |
caatgcattattatatgcagggaccggggttctaaccccggacaccccacttatt |
267 |
Q |
| |
|
||||||||||||||||||||| ||||||||| || |||||||||| |||||||| |
|
|
| T |
34960991 |
caatgcattattatatgcaggagccggggttcgaatcccggacaccacacttatt |
34960937 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #105
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 215 - 269
Target Start/End: Original strand, 47355835 - 47355889
Alignment:
| Q |
215 |
atgcattattatatgcagggaccggggttctaaccccggacaccccacttattca |
269 |
Q |
| |
|
||||||| |||||||||||| ||||||||| |||||| |||| |||||||||||| |
|
|
| T |
47355835 |
atgcattgttatatgcaggggccggggttcgaaccccagacatcccacttattca |
47355889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #106
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 188 - 277
Target Start/End: Complemental strand, 2756527 - 2756438
Alignment:
| Q |
188 |
cgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataa |
277 |
Q |
| |
|
||||| |||| ||||||||||||| ||||| |||||||||| || ||| | |||||| ||| ||| | || ||||||||| ||||||||| |
|
|
| T |
2756527 |
cgtgaacatagctcagttggtaggacaatgaattattatatacaaggatcagggttcgaactccgaatacgccacttattaaccttataa |
2756438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #107
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 182 - 279
Target Start/End: Complemental strand, 5749033 - 5748938
Alignment:
| Q |
182 |
atgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataagt |
279 |
Q |
| |
|
|||||| ||||||||| |||||||||| || ||||||||||||||| ||||| | |||||| |||| |||||| |||||||||| | ||||||||| |
|
|
| T |
5749033 |
atgtcctgtgagcatagctcagttggt-ggataatgcattattatatacaggg-gctgggttcgaacctcggacatcccacttatttatcttataagt |
5748938 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #108
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 183 - 236
Target Start/End: Complemental strand, 31279407 - 31279354
Alignment:
| Q |
183 |
tgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggac |
236 |
Q |
| |
|
|||||| ||| |||| ||||||||||||| ||||||||||||||||| |||||| |
|
|
| T |
31279407 |
tgtcccttgaacataactcagttggtaggacaatgcattattatatgtagggac |
31279354 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #109
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 237 - 278
Target Start/End: Complemental strand, 37129406 - 37129365
Alignment:
| Q |
237 |
cggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||| |||| |||||||||||||||||||||||||||| |
|
|
| T |
37129406 |
cggggttcaaacctcggacaccccacttattcaccttataag |
37129365 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #110
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 228 - 269
Target Start/End: Original strand, 40273860 - 40273901
Alignment:
| Q |
228 |
tgcagggaccggggttctaaccccggacaccccacttattca |
269 |
Q |
| |
|
||||||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
40273860 |
tgcaggggccggggttcgaaccccggacaccccacttattca |
40273901 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #111
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 228 - 269
Target Start/End: Complemental strand, 48433766 - 48433725
Alignment:
| Q |
228 |
tgcagggaccggggttctaaccccggacaccccacttattca |
269 |
Q |
| |
|
||||||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
48433766 |
tgcaggggccggggttcaaaccccggacaccccacttattca |
48433725 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #112
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 178 - 273
Target Start/End: Complemental strand, 7392413 - 7392317
Alignment:
| Q |
178 |
acaaatgtccc-gtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
||||||||||| ||||||||| |||| |||| ||| ||||||| |||||||||| | |||||| ||||||| |||||||||||||||||||| |
|
|
| T |
7392413 |
acaaatgtccccgtgagcatagctcaattggcaggaacatgcattgttatatgcagaggttggggtttgaaccccgaacaccccacttattcacctt |
7392317 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #113
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 185 - 272
Target Start/End: Original strand, 10958035 - 10958116
Alignment:
| Q |
185 |
tcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacct |
272 |
Q |
| |
|
||||||||||||| |||| |||| |||| ||||| |||||| ||||||| |||| ||||||||||||||||||||||||||| |
|
|
| T |
10958035 |
tcccgtgagcatagctcaattggcagggacatgcactattatgtgcaggg------gttcgaaccccggacaccccacttattcacct |
10958116 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #114
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 221 - 273
Target Start/End: Original strand, 15025188 - 15025240
Alignment:
| Q |
221 |
tattatatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
|||| ||| ||||| ||||||||| ||||||| |||||||||||||||||||| |
|
|
| T |
15025188 |
tattttatacaggggccggggttcaaaccccgaacaccccacttattcacctt |
15025240 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #115
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 186 - 257
Target Start/End: Original strand, 30566499 - 30566571
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacac |
257 |
Q |
| |
|
|||||||||||| ||| ||||| |||| ||||||||| ||||||| | || ||||||||| |||||||||||| |
|
|
| T |
30566499 |
cccgtgagcatagctcggttggcagggacaatgcattgttatatgtaagggccggggttcgaaccccggacac |
30566571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #116
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 199 - 264
Target Start/End: Original strand, 34891218 - 34891284
Alignment:
| Q |
199 |
ctcagttggtagggc--aatgcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
|||||||||||||| |||||||| |||||||||||| ||||||||| ||| ||||||||||||||| |
|
|
| T |
34891218 |
ctcagttggtagggacaaatgcatt-ttatatgcaggggccggggttcgaactccggacaccccactt |
34891284 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #117
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 221 - 273
Target Start/End: Original strand, 48525609 - 48525661
Alignment:
| Q |
221 |
tattatatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
|||||||||||||| ||||||| ||||||||||||| |||||||||||||| |
|
|
| T |
48525609 |
tattatatgcaggggttggggttcgaaccccggacacctcacttattcacctt |
48525661 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #118
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 221 - 264
Target Start/End: Complemental strand, 1398938 - 1398895
Alignment:
| Q |
221 |
tattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
|||||||||||||| ||||||||| || |||||||||||||||| |
|
|
| T |
1398938 |
tattatatgcaggggccggggttcgaatcccggacaccccactt |
1398895 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #119
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 186 - 264
Target Start/End: Original strand, 3766811 - 3766889
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaat-gcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||||||| || |||||||||||||| || |||| |||||||||||| ||||||||| |||||||||||| |||||| |
|
|
| T |
3766811 |
cccgtgagcttaactcagttggtagggatattgcat-attatatgcaggagccggggttcgaaccccggacactccactt |
3766889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #120
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 226 - 273
Target Start/End: Original strand, 5228107 - 5228154
Alignment:
| Q |
226 |
tatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
||||||||| ||||||||| || || |||||||||||||||||||||| |
|
|
| T |
5228107 |
tatgcaggggccggggttcgaatcctggacaccccacttattcacctt |
5228154 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #121
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 186 - 264
Target Start/End: Complemental strand, 10244959 - 10244881
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaat-gcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||||||| || |||||||||||||| || |||| |||||||| ||| ||||||||| ||||||||||||||||||| |
|
|
| T |
10244959 |
cccgtgagcttagctcagttggtagggatattgcat-attatatgtaggagccggggttcgaaccccggacaccccactt |
10244881 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #122
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 215 - 270
Target Start/End: Original strand, 16814723 - 16814778
Alignment:
| Q |
215 |
atgcattattatatgcagggaccggggttctaaccccggacaccccacttattcac |
270 |
Q |
| |
|
||||||||||||||| |||| |||||||| |||||| ||||| |||||||||||| |
|
|
| T |
16814723 |
atgcattattatatgtaggggtcggggttcgaaccccagacactccacttattcac |
16814778 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #123
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 186 - 264
Target Start/End: Complemental strand, 19753038 - 19752960
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaat-gcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||||||| || |||||||||||||| || |||| ||||||||||||| ||||||||| ||||| |||||| |||||| |
|
|
| T |
19753038 |
cccgtgagcttagctcagttggtagggatattgcat-attatatgcaggggccggggttcgaaccctggacactccactt |
19752960 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #124
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 186 - 264
Target Start/End: Original strand, 29617405 - 29617483
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaat-gcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||||||| || |||||||||||||| || |||| |||||||||||| ||||||||| |||||||||||| |||||| |
|
|
| T |
29617405 |
cccgtgagcttagctcagttggtagggatattgcat-attatatgcaggagccggggttcgaaccccggacactccactt |
29617483 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #125
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 186 - 264
Target Start/End: Original strand, 31026219 - 31026297
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaat-gcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||||||| || |||||||||||||| || |||| |||||||||||| ||||||||| |||||||||||| |||||| |
|
|
| T |
31026219 |
cccgtgagcgtagctcagttggtagggatattgcat-attatatgcaggagccggggttcgaaccccggacactccactt |
31026297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #126
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 223 - 274
Target Start/End: Complemental strand, 37995607 - 37995556
Alignment:
| Q |
223 |
ttatatgcagggaccggggttctaaccccggacaccccacttattcacctta |
274 |
Q |
| |
|
|||||||||||| ||||||||| |||||| |||||| ||||| ||||||||| |
|
|
| T |
37995607 |
ttatatgcaggggccggggttcaaaccccagacacctcacttgttcacctta |
37995556 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #127
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 226 - 273
Target Start/End: Complemental strand, 44662521 - 44662474
Alignment:
| Q |
226 |
tatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
||||||||| ||||||||| |||||||||||||||||| |||||||| |
|
|
| T |
44662521 |
tatgcaggggccggggttcgaaccccggacaccccactatttcacctt |
44662474 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #128
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 215 - 278
Target Start/End: Original strand, 44843718 - 44843780
Alignment:
| Q |
215 |
atgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||||||||| |||| |||||||| ||||| |||||||||| ||||||| |||||||| |
|
|
| T |
44843718 |
atgcattattatatgtaggggtcggggttcgaaccc-ggacaccccatttattcatcttataag |
44843780 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #129
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 185 - 224
Target Start/End: Original strand, 45197314 - 45197353
Alignment:
| Q |
185 |
tcccgtgagcatacctcagttggtagggcaatgcattatt |
224 |
Q |
| |
|
||||||||||||| ||||||||||||| |||||||||||| |
|
|
| T |
45197314 |
tcccgtgagcatagctcagttggtaggacaatgcattatt |
45197353 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #130
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 183 - 234
Target Start/End: Original strand, 45417467 - 45417518
Alignment:
| Q |
183 |
tgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcaggg |
234 |
Q |
| |
|
||||||||||||||| ||||||||| || ||||| |||||||||||||||| |
|
|
| T |
45417467 |
tgtcccgtgagcatagctcagttggcagaacaatgtattattatatgcaggg |
45417518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #131
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 184 - 274
Target Start/End: Complemental strand, 3481268 - 3481179
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctta |
274 |
Q |
| |
|
|||||||||||||| ||||| ||||| || |||||| ||||||||||| ||||||||| ||| || || ||| ||||||||||||||| |
|
|
| T |
3481268 |
gtcccgtgagcataactcaggtggtatggacgtgcattgttatatgcaggagccggggttcgaactcc-gatacctcacttattcacctta |
3481179 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #132
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 221 - 259
Target Start/End: Complemental strand, 15074937 - 15074899
Alignment:
| Q |
221 |
tattatatgcagggaccggggttctaaccccggacaccc |
259 |
Q |
| |
|
|||||||||||||||||||||||| || ||||||||||| |
|
|
| T |
15074937 |
tattatatgcagggaccggggttcgaatcccggacaccc |
15074899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #133
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 215 - 273
Target Start/End: Complemental strand, 24579355 - 24579297
Alignment:
| Q |
215 |
atgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
|||||||||||||||||||| | | ||| |||||| ||||||||||||||||||||| |
|
|
| T |
24579355 |
atgcattattatatgcaggggatgagattcgaaccccagacaccccacttattcacctt |
24579297 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #134
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 183 - 233
Target Start/End: Complemental strand, 28694287 - 28694237
Alignment:
| Q |
183 |
tgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagg |
233 |
Q |
| |
|
|||||| |||||||| |||||||| |||| || |||||||||||||||||| |
|
|
| T |
28694287 |
tgtcccatgagcatagctcagttgataggacagtgcattattatatgcagg |
28694237 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #135
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 187 - 264
Target Start/End: Original strand, 36174391 - 36174468
Alignment:
| Q |
187 |
ccgtgagcatacctcagttggtagggcaat-gcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
|||||||| || |||||||||||||| || |||| |||||||||||| ||||||||| |||||||||||| |||||| |
|
|
| T |
36174391 |
ccgtgagcttagctcagttggtagggatattgcat-attatatgcaggagccggggttcgaaccccggacactccactt |
36174468 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #136
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 226 - 264
Target Start/End: Original strand, 36932013 - 36932051
Alignment:
| Q |
226 |
tatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
36932013 |
tatgcagggtccggggttcgaaccccggacaccccactt |
36932051 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #137
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 228 - 274
Target Start/End: Complemental strand, 42841837 - 42841791
Alignment:
| Q |
228 |
tgcagggaccggggttctaaccccggacaccccacttattcacctta |
274 |
Q |
| |
|
|||| |||||||||||| |||||| ||||||||||||||||| |||| |
|
|
| T |
42841837 |
tgcaaggaccggggttcgaaccccagacaccccacttattcatctta |
42841791 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #138
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 184 - 273
Target Start/End: Original strand, 1513482 - 1513571
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
|||| ||||||||| |||||||| |||| ||||||| ||||||| |||| | ||||| ||| ||| |||||||||||||||||||| |
|
|
| T |
1513482 |
gtcctgtgagcataaatcagttggcagggacatgcattgttatatgtaggggttgaggttcgaacaccgaacaccccacttattcacctt |
1513571 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #139
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 215 - 268
Target Start/End: Original strand, 23799326 - 23799379
Alignment:
| Q |
215 |
atgcattattatatgcagggaccggggttctaaccccggacaccccacttattc |
268 |
Q |
| |
|
||||||| |||||||||||| |||| ||| |||| |||||||||||||||||| |
|
|
| T |
23799326 |
atgcattgttatatgcaggggtcgggattcgaacctcggacaccccacttattc |
23799379 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #140
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 221 - 270
Target Start/End: Complemental strand, 26801764 - 26801715
Alignment:
| Q |
221 |
tattatatgcagggaccggggttctaaccccggacaccccacttattcac |
270 |
Q |
| |
|
||||||||||||| ||||||||| |||||||||||| |||||| ||||| |
|
|
| T |
26801764 |
tattatatgcaggagccggggttcgaaccccggacactccacttcttcac |
26801715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #141
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 236 - 273
Target Start/End: Complemental strand, 28693886 - 28693849
Alignment:
| Q |
236 |
ccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
||||||||| |||||||||||||| ||||||||||||| |
|
|
| T |
28693886 |
ccggggttcgaaccccggacaccctacttattcacctt |
28693849 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #142
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 188 - 264
Target Start/End: Complemental strand, 30388575 - 30388499
Alignment:
| Q |
188 |
cgtgagcatacctcagttggtagggcaat-gcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||||| || |||||||||||||| || |||| ||||||||||||| ||||||||| |||||| ||||| |||||| |
|
|
| T |
30388575 |
cgtgagcttagctcagttggtagggatattgcat-attatatgcaggggccggggttcgaaccccagacactccactt |
30388499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #143
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 228 - 269
Target Start/End: Original strand, 31793507 - 31793548
Alignment:
| Q |
228 |
tgcagggaccggggttctaaccccggacaccccacttattca |
269 |
Q |
| |
|
||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
31793507 |
tgcaggggtcggggttcgaaccccggacaccccacttattca |
31793548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #144
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 223 - 264
Target Start/End: Original strand, 32047126 - 32047167
Alignment:
| Q |
223 |
ttatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
|||||||||||| ||||||||| ||||||||||||| ||||| |
|
|
| T |
32047126 |
ttatatgcaggggccggggttcgaaccccggacacctcactt |
32047167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #145
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 184 - 229
Target Start/End: Complemental strand, 35919771 - 35919726
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatg |
229 |
Q |
| |
|
|||||||||||||| |||||||| || | ||||||||||||||||| |
|
|
| T |
35919771 |
gtcccgtgagcatagctcagttgttaagacaatgcattattatatg |
35919726 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #146
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 228 - 269
Target Start/End: Original strand, 38378258 - 38378299
Alignment:
| Q |
228 |
tgcagggaccggggttctaaccccggacaccccacttattca |
269 |
Q |
| |
|
||||||| |||||||| |||||||||||||||||||||||| |
|
|
| T |
38378258 |
tgcaggggccggggtttgaaccccggacaccccacttattca |
38378299 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #147
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 213 - 278
Target Start/End: Original strand, 42286348 - 42286413
Alignment:
| Q |
213 |
caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||| ||||||| |||| | | |||| ||| |||||||||||||||||| |||||||||| |
|
|
| T |
42286348 |
caatgcattgttatatgtaggggctgaggtttgaacaccggacaccccacttatttaccttataag |
42286413 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #148
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 214 - 278
Target Start/End: Complemental strand, 4042338 - 4042274
Alignment:
| Q |
214 |
aatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||||||||||||||| ||| |||| ||| ||||||||| ||||||||| ||||||| |
|
|
| T |
4042338 |
aatgcattattatatgcaggggtcggagttcgaacttcggacacccaacttattcattttataag |
4042274 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #149
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 250 - 278
Target Start/End: Original strand, 8214171 - 8214199
Alignment:
| Q |
250 |
ccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||||||||||||||||||||||| |
|
|
| T |
8214171 |
ccggacaccccacttattcaccttataag |
8214199 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #150
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 186 - 261
Target Start/End: Complemental strand, 23274884 - 23274809
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacacccca |
261 |
Q |
| |
|
||||||||| || || ||||||||||| || ||||| ||| ||||||||| |||| |||| |||||||||||||||| |
|
|
| T |
23274884 |
cccgtgagcttagctaagttggtagggacattgcataatt-tatgcaggggccggagttcgaaccccggacacccca |
23274809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #151
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 185 - 264
Target Start/End: Original strand, 24781029 - 24781108
Alignment:
| Q |
185 |
tcccgtgagcatacctcagttggtagggcaat-gcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
|||||||||| || |||||||||||||| || |||| |||||||||||| ||||||||| ||||||||| || |||||| |
|
|
| T |
24781029 |
tcccgtgagcttagctcagttggtagggatattgcat-attatatgcaggagccggggttcgaaccccggatactccactt |
24781108 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #152
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 185 - 264
Target Start/End: Complemental strand, 35683198 - 35683119
Alignment:
| Q |
185 |
tcccgtgagcatacctcagttggtagggcaat-gcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
|||||||||| || |||||||||||||| || ||||| |||||||||||| |||||||| ||| |||||||| |||||| |
|
|
| T |
35683198 |
tcccgtgagcttagctcagttggtagggatatcgcatt-ttatatgcaggggtcggggttcgaactccggacactccactt |
35683119 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #153
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 185 - 273
Target Start/End: Complemental strand, 38328665 - 38328578
Alignment:
| Q |
185 |
tcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
|||| |||||||| |||| ||||||||| || |||| ||||||||| |||| || |||| |||||| |||||||| ||||||||||| |
|
|
| T |
38328665 |
tcccatgagcatagctcaattggtagggacatacattgttatatgca-ggactggagttcgaaccccaaacaccccatttattcacctt |
38328578 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #154
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 182 - 263
Target Start/End: Original strand, 46758237 - 46758319
Alignment:
| Q |
182 |
atgtcccgtgagcatacctcagttggtagggc--aatgcattattatatgcagggaccggggttctaaccccggacaccccact |
263 |
Q |
| |
|
||||||||||||| |||||||||||||| |||||||| |||||||||||| |||||||| ||| |||||||||||||| |
|
|
| T |
46758237 |
atgtcccgtgagctctgctcagttggtagggacaaatgcatt-ttatatgcaggggtcggggttcgaactccggacaccccact |
46758319 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #155
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 186 - 270
Target Start/End: Original strand, 48053146 - 48053230
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcac |
270 |
Q |
| |
|
|||||||||||| || ||||||||||| || |||| ||||||| |||| |||| ||| || | ||||||||||||||||||| |
|
|
| T |
48053146 |
cccgtgagcatagcttagttggtagggacatacattcttatatgtaggggtcgggattcgaatcatggacaccccacttattcac |
48053230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7; HSP #156
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 189 - 264
Target Start/End: Original strand, 48119473 - 48119548
Alignment:
| Q |
189 |
gtgagcatacctcagttggtagggcaat-gcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
|||||| || |||||||||||||| || ||||| |||||||||||| ||| ||||| |||||||||||| |||||| |
|
|
| T |
48119473 |
gtgagcttagctcagttggtagggatattgcatt-ttatatgcaggggccgaggttcgaaccccggacactccactt |
48119548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 72; Significance: 9e-33; HSPs: 179)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 72; E-Value: 9e-33
Query Start/End: Original strand, 183 - 278
Target Start/End: Complemental strand, 15774413 - 15774318
Alignment:
| Q |
183 |
tgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||||||||| ||||||||||||| ||||||||||||||||| |||| |||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
15774413 |
tgtcccgtgagcataactcagttggtaggacaatgcattattatatgtaggggtcggggttcgaaccccggacaccccacttattcaccttataag |
15774318 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #2
Raw Score: 72; E-Value: 9e-33
Query Start/End: Original strand, 183 - 278
Target Start/End: Original strand, 42831941 - 42832036
Alignment:
| Q |
183 |
tgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||||||||| ||||||||||||| || ||||||||||||||||||| | ||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
42831941 |
tgtcccgtgagcatagctcagttggtaggacattgcattattatatgcaggggctggggttcaaaccccggacaccccacttattcaccttataag |
42832036 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #3
Raw Score: 69; E-Value: 5e-31
Query Start/End: Original strand, 182 - 278
Target Start/End: Complemental strand, 43555976 - 43555880
Alignment:
| Q |
182 |
atgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||| |||||||||| ||||||||||||| ||||||||||||||||||||||| |||||||| ||||| |||||||||||||||| |||||||||| |
|
|
| T |
43555976 |
atgtctcgtgagcatagctcagttggtaggacaatgcattattatatgcagggatcggggttcaaacccaggacaccccacttatttaccttataag |
43555880 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #4
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 183 - 277
Target Start/End: Complemental strand, 4354206 - 4354112
Alignment:
| Q |
183 |
tgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataa |
277 |
Q |
| |
|
||||| ||||||||| ||||||||||||| |||||||||||||||||||||| ||||||||| ||| ||||||||||||||||||||||||||| |
|
|
| T |
4354206 |
tgtcctgtgagcatagctcagttggtaggacaatgcattattatatgcaggggccggggttcgaacttcggacaccccacttattcaccttataa |
4354112 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #5
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 184 - 278
Target Start/End: Original strand, 21884570 - 21884664
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||||||| |||| |||||||| |||||||||||||||||||||| ||| ||||| |||||| |||||||||||||||||||||||||| |
|
|
| T |
21884570 |
gtcccgtgagcatagctcaattggtaggacaatgcattattatatgcaggggccgaggttcgaaccccagacaccccacttattcaccttataag |
21884664 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #6
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 183 - 277
Target Start/End: Original strand, 27745151 - 27745245
Alignment:
| Q |
183 |
tgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataa |
277 |
Q |
| |
|
||||||||||||||| |||| |||||||| |||||||||||||||||||||| |||||||| |||||||||||||||| ||||||||||||||| |
|
|
| T |
27745151 |
tgtcccgtgagcatagctcatttggtaggaaaatgcattattatatgcagggatcggggttcgaaccccggacaccccatttattcaccttataa |
27745245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #7
Raw Score: 67; E-Value: 8e-30
Query Start/End: Original strand, 183 - 277
Target Start/End: Complemental strand, 49251496 - 49251402
Alignment:
| Q |
183 |
tgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataa |
277 |
Q |
| |
|
||||| ||||||||| ||||||||||||| |||||||||||||||||||||| |||||||| |||||| ||||||||||||||||||||||||| |
|
|
| T |
49251496 |
tgtcctgtgagcataactcagttggtaggacaatgcattattatatgcaggggtcggggttcgaaccccagacaccccacttattcaccttataa |
49251402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #8
Raw Score: 66; E-Value: 3e-29
Query Start/End: Original strand, 189 - 278
Target Start/End: Original strand, 19793526 - 19793615
Alignment:
| Q |
189 |
gtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||| ||||||||||||| |||||||||||||||||||||| |||| ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
19793526 |
gtgagcataactcagttggtaggacaatgcattattatatgcaggggccggaattcgaaccccggacaccccacttattcaccttataag |
19793615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #9
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 182 - 278
Target Start/End: Complemental strand, 538431 - 538335
Alignment:
| Q |
182 |
atgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||||||||| ||||||||||| |||||||||||||||||||||| |||| |||| ||||||| ||||||||||||||||||||||||| |
|
|
| T |
538431 |
atgtcccgtgagcatagttcagttggtagaacaatgcattattatatgcaggggccggagttcgaaccccgaacaccccacttattcaccttataag |
538335 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #10
Raw Score: 65; E-Value: 1e-28
Query Start/End: Original strand, 182 - 278
Target Start/End: Complemental strand, 46116276 - 46116180
Alignment:
| Q |
182 |
atgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||||||||| || |||||||||| ||||||||||| |||||||||| | ||||||| |||||||||||||||| |||||||||||||||| |
|
|
| T |
46116276 |
atgtcccgtgagcatagcttagttggtaggacaatgcattatcatatgcaggggctggggttcgaaccccggacaccccaattattcaccttataag |
46116180 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #11
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 183 - 278
Target Start/End: Complemental strand, 18923986 - 18923891
Alignment:
| Q |
183 |
tgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||||||||| ||||||||||||| |||||||||||||||||||||| | |||||| |||| |||||||||||| ||||||||||||||| |
|
|
| T |
18923986 |
tgtcccgtgagcatagctcagttggtaggacaatgcattattatatgcagggttcagggttcgaacctcggacaccccacgtattcaccttataag |
18923891 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #12
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 183 - 278
Target Start/End: Complemental strand, 23464087 - 23463992
Alignment:
| Q |
183 |
tgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||| |||||||| |||||||||||| |||||||||||||||||||||| ||||||||| ||||||||||||||||||| ||||| ||||||| |
|
|
| T |
23464087 |
tgtcccatgagcatagttcagttggtaggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttgttcactttataag |
23463992 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #13
Raw Score: 64; E-Value: 5e-28
Query Start/End: Original strand, 183 - 278
Target Start/End: Original strand, 37490884 - 37490979
Alignment:
| Q |
183 |
tgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||||||||| ||||||||||||| |||||||||||||||||||||| ||||||| | |||| |||||||||| |||||||| |||||||| |
|
|
| T |
37490884 |
tgtcccgtgagcataactcagttggtaggacaatgcattattatatgcaggggccggggtacgaaccacggacaccccgcttattcatcttataag |
37490979 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #14
Raw Score: 63; E-Value: 2e-27
Query Start/End: Original strand, 184 - 277
Target Start/End: Complemental strand, 38020048 - 38019954
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttc-taaccccggacaccccacttattcaccttataa |
277 |
Q |
| |
|
|||||||||||||| ||||||||||||| |||||||||||||||||||||| |||| |||| |||||| ||||||||||||||||||||||||| |
|
|
| T |
38020048 |
gtcccgtgagcatagctcagttggtaggacaatgcattattatatgcaggggccggagttcgaaaccccagacaccccacttattcaccttataa |
38019954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #15
Raw Score: 62; E-Value: 8e-27
Query Start/End: Original strand, 189 - 278
Target Start/End: Original strand, 37733755 - 37733844
Alignment:
| Q |
189 |
gtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||| |||| ||||||||||||| |||||||||||||||||||| | |||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
37733755 |
gtgaacatagctcagttggtaggacaatgcattattatatgcagtggacggggttcgaaccccggacaccccacttattcaccttataag |
37733844 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #16
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 186 - 281
Target Start/End: Original strand, 17350057 - 17350153
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataagtga |
281 |
Q |
| |
|
|||||||| ||| ||||||||| |||| |||||||||||||||||||||| ||||||||| ||||||||||||||||||||||||| ||| |||||| |
|
|
| T |
17350057 |
cccgtgagtatagctcagttggcagggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttattcactttaaaagtga |
17350153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #17
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 186 - 281
Target Start/End: Original strand, 39238712 - 39238808
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataagtga |
281 |
Q |
| |
|
|||||||||||| ||||||||| |||| |||||||||||||||||||||| ||| ||||| ||||||||||||||||||||||||| ||| |||||| |
|
|
| T |
39238712 |
cccgtgagcatagctcagttggcagggacaatgcattattatatgcaggggccgaggttcgaaccccggacaccccacttattcactttaaaagtga |
39238808 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #18
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 186 - 281
Target Start/End: Original strand, 40678819 - 40678915
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataagtga |
281 |
Q |
| |
|
|||||||||||| ||||||||| |||| |||||||||||||||||||||| ||||||||| | ||||||||||||||||||||||| ||| |||||| |
|
|
| T |
40678819 |
cccgtgagcatagctcagttggcagggacaatgcattattatatgcaggggccggggttcgatccccggacaccccacttattcactttaaaagtga |
40678915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #19
Raw Score: 60; E-Value: 1e-25
Query Start/End: Original strand, 199 - 278
Target Start/End: Original strand, 15368815 - 15368894
Alignment:
| Q |
199 |
ctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||||||| |||||||||||||||||||||| ||||||||| |||||||||||||||||||||||| ||||||| |
|
|
| T |
15368815 |
ctcagttggtaggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccacttattcattttataag |
15368894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #20
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 184 - 278
Target Start/End: Complemental strand, 3533073 - 3532980
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||||||| ||||||| ||||| ||||||||||||||||| |||| |||| ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
3533073 |
gtcccgtgagcatagctcagttagtaggacaatgcattattatatgtaggggtcggg-ttccaaccccggacaccccacttattcaccttataag |
3532980 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #21
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 183 - 277
Target Start/End: Complemental strand, 23930645 - 23930551
Alignment:
| Q |
183 |
tgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataa |
277 |
Q |
| |
|
||||||||||||||| |||||||||||| |||||||||||||||||||||| |||||||| ||||| |||||||||| ||||| ||||||||| |
|
|
| T |
23930645 |
tgtcccgtgagcatagttcagttggtaggacaatgcattattatatgcaggggtcggggttcgaaccctggacaccccatttatttaccttataa |
23930551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #22
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 186 - 270
Target Start/End: Original strand, 29491466 - 29491551
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcac |
270 |
Q |
| |
|
|||||||||||| ||||||||| |||| |||||||||||||||||||||| |||||||| ||||||||||||||||||||||||| |
|
|
| T |
29491466 |
cccgtgagcatagctcagttggcagggacaatgcattattatatgcaggggtcggggttcgaaccccggacaccccacttattcac |
29491551 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #23
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 186 - 281
Target Start/End: Original strand, 38021248 - 38021344
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataagtga |
281 |
Q |
| |
|
|||||||||||| ||||||||| | || |||||||||||||||||||||| |||| |||| ||||||||||||||||||||||||| ||| |||||| |
|
|
| T |
38021248 |
cccgtgagcatagctcagttggcaaggacaatgcattattatatgcaggggccggagttcgaaccccggacaccccacttattcactttaaaagtga |
38021344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #24
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 186 - 273
Target Start/End: Complemental strand, 9768907 - 9768820
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
|||||||||||| ||||||||| |||| ||||||| |||||||||||| |||||||| |||||||||||||||||||||||||||| |
|
|
| T |
9768907 |
cccgtgagcatagctcagttggcagggacatgcattgttatatgcaggggtcggggttcgaaccccggacaccccacttattcacctt |
9768820 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #25
Raw Score: 56; E-Value: 3e-23
Query Start/End: Original strand, 187 - 274
Target Start/End: Complemental strand, 24168676 - 24168589
Alignment:
| Q |
187 |
ccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctta |
274 |
Q |
| |
|
||||||||||| ||||||| ||||| ||||||||||||||| |||||||||||||| |||||| |||||||||||||||||||||| |
|
|
| T |
24168676 |
ccgtgagcatagctcagtttgtaggaacatgcattattatatgtagggaccggggttcgaaccccagacaccccacttattcacctta |
24168589 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #26
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 184 - 278
Target Start/End: Original strand, 20357455 - 20357548
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||||||| ||||||||||||| |||||||||||||||||||||| | ||||||| || |||||||| | |||||||||||||||||| |
|
|
| T |
20357455 |
gtcccgtgagcataactcagttggtaggacaatgcattattatatgcaggggctggggttcgaa-cccggacaactaacttattcaccttataag |
20357548 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #27
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 184 - 278
Target Start/End: Complemental strand, 20562500 - 20562407
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||||||| ||||||||||||| |||||||||||||||||||||| | ||||||| || |||||||| | |||||||||||||||||| |
|
|
| T |
20562500 |
gtcccgtgagcataactcagttggtaggacaatgcattattatatgcaggggctggggttcgaa-cccggacaactaacttattcaccttataag |
20562407 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #28
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 199 - 273
Target Start/End: Complemental strand, 50199561 - 50199487
Alignment:
| Q |
199 |
ctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
|||||||||||||| ||||||| |||||||||||| ||||||||| |||||||||||||||||||||||||||| |
|
|
| T |
50199561 |
ctcagttggtagggacatgcattgttatatgcaggggccggggttcgaaccccggacaccccacttattcacctt |
50199487 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #29
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 184 - 281
Target Start/End: Complemental strand, 52833207 - 52833109
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataagtga |
281 |
Q |
| |
|
||||||||||| || ||||||||| |||| |||||||||||||||||||||| ||||||||| ||||||||||| |||| |||||||| ||| |||||| |
|
|
| T |
52833207 |
gtcccgtgagcctaactcagttggcagggacaatgcattattatatgcaggggccggggttcgaaccccggacatcccatttattcactttaaaagtga |
52833109 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #30
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 186 - 266
Target Start/End: Complemental strand, 2052781 - 2052700
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccacttat |
266 |
Q |
| |
|
|||||||||||| ||||||||| |||| ||||||||||| |||||||||| ||||||||| ||||||||||||||||||||| |
|
|
| T |
2052781 |
cccgtgagcatagctcagttggcagggacaatgcattatcatatgcaggggccggggttcgaaccccggacaccccacttat |
2052700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #31
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 189 - 281
Target Start/End: Complemental strand, 13870177 - 13870084
Alignment:
| Q |
189 |
gtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataagtga |
281 |
Q |
| |
|
||||||||| ||||||||| |||| |||||||||||||||||||||| |||||||| || |||||||||||||||||||||| ||| |||||| |
|
|
| T |
13870177 |
gtgagcatagctcagttggcagggacaatgcattattatatgcaggggccggggtttgaatcccggacaccccacttattcactttaaaagtga |
13870084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #32
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 185 - 281
Target Start/End: Complemental strand, 47763485 - 47763388
Alignment:
| Q |
185 |
tcccgtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataagtga |
281 |
Q |
| |
|
||||||||||||| ||||||||| |||| |||||||||||||||||||||| |||| |||| |||| |||||| ||||||||||||| ||| |||||| |
|
|
| T |
47763485 |
tcccgtgagcatagctcagttggcagggacaatgcattattatatgcaggggccggagttcgaacctcggacatcccacttattcactttaaaagtga |
47763388 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #33
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 193 - 273
Target Start/End: Complemental strand, 3341827 - 3341747
Alignment:
| Q |
193 |
gcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
||||| ||||||||| |||| |||||||||||||||||||| |||||| || |||||||||||||||||||||||||||| |
|
|
| T |
3341827 |
gcatagctcagttggcagggacatgcattattatatgcaggggccggggatcgaaccccggacaccccacttattcacctt |
3341747 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #34
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 186 - 281
Target Start/End: Original strand, 25819181 - 25819277
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataagtga |
281 |
Q |
| |
|
|||||||||||| ||||||||| |||| ||||||||||||||||| ||| ||||||||| ||||||||| ||||||||||||||| ||| |||||| |
|
|
| T |
25819181 |
cccgtgagcatagctcagttggcagggacaatgcattattatatgtaggagccggggttcgaaccccggataccccacttattcactttaaaagtga |
25819277 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #35
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 190 - 273
Target Start/End: Complemental strand, 9769674 - 9769591
Alignment:
| Q |
190 |
tgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
|||||||| ||||||||| |||| ||||||||||||||| ||||| ||||||| |||||||||||||||||||||||||||| |
|
|
| T |
9769674 |
tgagcatagctcagttggcagggacatgcattattatatgtagggattggggttcgaaccccggacaccccacttattcacctt |
9769591 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #36
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 203 - 274
Target Start/End: Complemental strand, 17056961 - 17056890
Alignment:
| Q |
203 |
gttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctta |
274 |
Q |
| |
|
||||||||| |||||||||||||||||||||| ||||||||| |||||| ||| |||||||||||||||||| |
|
|
| T |
17056961 |
gttggtaggacaatgcattattatatgcaggggccggggttcgaaccccagacgccccacttattcacctta |
17056890 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #37
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 190 - 281
Target Start/End: Original strand, 17889062 - 17889153
Alignment:
| Q |
190 |
tgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataagtga |
281 |
Q |
| |
|
||||| || ||||||||||||| |||| ||||||||||||||| | |||||||| ||| ||||||| |||||||||||||||||||||||| |
|
|
| T |
17889062 |
tgagcttaactcagttggtaggataatgtattattatatgcaggaatcggggttcgaactccggacatcccacttattcaccttataagtga |
17889153 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #38
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 183 - 278
Target Start/End: Complemental strand, 29331265 - 29331170
Alignment:
| Q |
183 |
tgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||||||||| || |||||||||| |||||||||||||||||||||| ||||| ||| |||| ||||||||| | ||||| || ||||||| |
|
|
| T |
29331265 |
tgtcccgtgagcatagcttagttggtaggacaatgcattattatatgcagggtccgggattcgaacctcggacaccctatttatttacattataag |
29331170 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #39
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 183 - 278
Target Start/End: Original strand, 39433352 - 39433447
Alignment:
| Q |
183 |
tgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||| |||||||| |||||||||| | ||||||||||||||||||||| ||| |||| |||| |||||||||||||||||||||||||||| |
|
|
| T |
39433352 |
tgtcccatgagcatagttcagttggtatgaaaatgcattattatatgcaggggccgatgttcgaacctcggacaccccacttattcaccttataag |
39433447 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #40
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 185 - 276
Target Start/End: Complemental strand, 43837500 - 43837409
Alignment:
| Q |
185 |
tcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttata |
276 |
Q |
| |
|
||||||||||||| ||||||||||||| |||||||| || ||||||||| |||||||| ||||| |||||||||| |||||||||||||| |
|
|
| T |
43837500 |
tcccgtgagcatagctcagttggtaggaaaatgcattcttctatgcaggggtcggggttcgaaccctggacaccccatttattcaccttata |
43837409 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #41
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 180 - 278
Target Start/End: Complemental strand, 4429586 - 4429488
Alignment:
| Q |
180 |
aaatgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||| ||||||||||| ||||||||||||| |||||||||||||||||||||| ||||||| ||||| | ||| ||||||||||| |||||||| |
|
|
| T |
4429586 |
aaatgttccgtgagcatagctcagttggtaggacaatgcattattatatgcaggggttggggttcgaaccctgaacattccacttattcatcttataag |
4429488 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #42
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 186 - 272
Target Start/End: Original strand, 18003813 - 18003899
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacct |
272 |
Q |
| |
|
|||||||||||| ||||||||| |||| ||||||| |||||||||||| ||||||||| | ||||| ||||||||||||||||||| |
|
|
| T |
18003813 |
cccgtgagcatagctcagttggcagggacatgcattgttatatgcaggggccggggttcgagccccgaacaccccacttattcacct |
18003899 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #43
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 184 - 278
Target Start/End: Original strand, 24661977 - 24662071
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||||||| |||| |||||||| |||||||||||||||||||||| | || ||| |||||| ||||||||| ||||||| |||||||| |
|
|
| T |
24661977 |
gtcccgtgagcatagctcaattggtaggacaatgcattattatatgcaggggtcaggattcgaaccccagacaccccatttattcaacttataag |
24662071 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #44
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 183 - 277
Target Start/End: Original strand, 30649087 - 30649181
Alignment:
| Q |
183 |
tgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataa |
277 |
Q |
| |
|
||||||||||||| | |||||||| |||| ||| ||||||||||||||||| ||||||| |||||| ||||||||||||||||||||||||| |
|
|
| T |
30649087 |
tgtcccgtgagcaaagctcagttgataggacaacgcattattatatgcaggagttggggttcgaaccccagacaccccacttattcaccttataa |
30649181 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #45
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 204 - 278
Target Start/End: Complemental strand, 32711223 - 32711150
Alignment:
| Q |
204 |
ttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||| |||||||||||||||||||||| ||||||||| |||||| |||||||||||||||||||||||||| |
|
|
| T |
32711223 |
ttggtagaacaatgcattattatatgcaggg-ccggggttcgaaccccagacaccccacttattcaccttataag |
32711150 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #46
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 184 - 278
Target Start/End: Complemental strand, 40814866 - 40814772
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||||||| ||||||| ||| | |||||||||||||||||||||| |||||||| || |||||||||||| ||| |||||||||||| |
|
|
| T |
40814866 |
gtcccgtgagcatagctcagttagtaagacaatgcattattatatgcaggggtcggggttcgaaacccggacaccccgcttgctcaccttataag |
40814772 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #47
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 184 - 278
Target Start/End: Complemental strand, 49606798 - 49606704
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||| |||||| |||||||| |||| ||||||||||||||||| |||| |||| |||| ||| ||||||||||||||||||| |||||||| |
|
|
| T |
49606798 |
gtcccgtaagcatagctcagttgttaggacaatgcattattatatgtaggggccggagttcgaacttcggacaccccacttattcagcttataag |
49606704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #48
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 189 - 274
Target Start/End: Original strand, 1721140 - 1721225
Alignment:
| Q |
189 |
gtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctta |
274 |
Q |
| |
|
||||||||| ||||||||||||| ||||||| |||||||||||| ||||| ||| ||||||||||||| ||||||||||||||| |
|
|
| T |
1721140 |
gtgagcatagctcagttggtaggaacatgcattgttatatgcaggggccgggtttcgaaccccggacacctcacttattcacctta |
1721225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #49
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 186 - 278
Target Start/End: Original strand, 9527422 - 9527515
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||||| ||||||||| |||| ||||||||| |||||||||||| ||||||| ||||| |||||||||||||||||| |||||||| |
|
|
| T |
9527422 |
cccgtgagcatagctcagttggcagggacaatgcattgttatatgcaggggtcggggtttgaaccctggacaccccacttattcatcttataag |
9527515 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #50
Raw Score: 50; E-Value: 1e-19
Query Start/End: Original strand, 213 - 278
Target Start/End: Original strand, 11405480 - 11405545
Alignment:
| Q |
213 |
caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||| |||||||||||| |||||||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
11405480 |
caatgcattgttatatgcaggggtcggggttcgaaccccggacaccccacttattcaccttataag |
11405545 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #51
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 186 - 281
Target Start/End: Complemental strand, 19976651 - 19976555
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataagtga |
281 |
Q |
| |
|
|||||||||||| ||||||||| |||| ||||| || |||||||||||| ||||||||| ||||||||||||||||| ||||||| ||| |||||| |
|
|
| T |
19976651 |
cccgtgagcatagctcagttggcagggacaatgtatggttatatgcaggggccggggttcgaaccccggacaccccacatattcactttaaaagtga |
19976555 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #52
Raw Score: 49; E-Value: 5e-19
Query Start/End: Original strand, 186 - 270
Target Start/End: Complemental strand, 52961180 - 52961096
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcac |
270 |
Q |
| |
|
|||||||||||| ||||||||| | || ||||||| |||||||||||| ||||||||| |||||||||| |||||||||||||| |
|
|
| T |
52961180 |
cccgtgagcatagctcagttggcaaggacatgcattgttatatgcaggggccggggttcgaaccccggacgccccacttattcac |
52961096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #53
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 187 - 278
Target Start/End: Complemental strand, 749683 - 749593
Alignment:
| Q |
187 |
ccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||||| |||||||||| | ||||||||||||||||| |||| ||||||| |||||| |||||||||||||||||||||||||| |
|
|
| T |
749683 |
ccgtgagcataactcagttggtcgaacaatgcattattatatgtaggggttggggttcgaacccc-gacaccccacttattcaccttataag |
749593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #54
Raw Score: 48; E-Value: 2e-18
Query Start/End: Original strand, 183 - 266
Target Start/End: Complemental strand, 9408715 - 9408632
Alignment:
| Q |
183 |
tgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttat |
266 |
Q |
| |
|
||||||||||||||| ||||||||||||| ||||||||||||| |||||||| ||| |||| || |||||||| ||||||||| |
|
|
| T |
9408715 |
tgtcccgtgagcatagctcagttggtaggacaatgcattattaaatgcaggggtcggagttcgaatcccggacaacccacttat |
9408632 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #55
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 187 - 276
Target Start/End: Complemental strand, 8261772 - 8261684
Alignment:
| Q |
187 |
ccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttata |
276 |
Q |
| |
|
||||||||||| ||||||||||||| ||||||||||||||||||||| |||||||| || ||| |||| |||||||||||| |||||| |
|
|
| T |
8261772 |
ccgtgagcatagctcagttggtaggataatgcattattatatgcaggggtcggggttccaatcccagaca-cccacttattcatcttata |
8261684 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #56
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 184 - 277
Target Start/End: Complemental strand, 12073177 - 12073084
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataa |
277 |
Q |
| |
|
|||||||||||||| ||||||||||||| ||||||||||||||| | ||| || ||||| ||| |||||||||| | ||||||||||||||| |
|
|
| T |
12073177 |
gtcccgtgagcataactcagttggtaggataatgcattattatatctaaggatcgaggttcgaactccggacacccaatttattcaccttataa |
12073084 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #57
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 188 - 277
Target Start/End: Complemental strand, 24014704 - 24014615
Alignment:
| Q |
188 |
cgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataa |
277 |
Q |
| |
|
|||||| ||| ||||||||||| | |||||||||||||||||||||| |||| |||| ||| | |||||||||| ||||||| ||||||| |
|
|
| T |
24014704 |
cgtgagtatagctcagttggtaagacaatgcattattatatgcaggggccggagttcgaactctggacaccccaattattcaacttataa |
24014615 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #58
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 185 - 278
Target Start/End: Original strand, 48110525 - 48110618
Alignment:
| Q |
185 |
tcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||| || |||||||||||| |||||||||||||||||||||| || |||| |||| |||||||| |||||||||| |||||||| |
|
|
| T |
48110525 |
tcccgtgagcgtagctcagttggtagaacaatgcattattatatgcaggggttggagttcgaacctcggacacctcacttattcatcttataag |
48110618 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #59
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 186 - 274
Target Start/End: Original strand, 3797852 - 3797940
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctta |
274 |
Q |
| |
|
|||||||||||| ||||||||||| || |||||| |||||||| |||| | ||||||| ||||| |||||||||||||||||||||| |
|
|
| T |
3797852 |
cccgtgagcataactcagttggtaaggatatgcataattatatgtaggggctggggttcgaaccctagacaccccacttattcacctta |
3797940 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #60
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 186 - 274
Target Start/End: Complemental strand, 7906424 - 7906336
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctta |
274 |
Q |
| |
|
|||||||||||| ||||||||||||| ||||||| |||||||||||| | ||||||| ||||| ||||||||| |||||| |||||| |
|
|
| T |
7906424 |
cccgtgagcatagttcagttggtagggacatgcattgttatatgcaggggctggggttcgaacccgggacaccccgcttattgacctta |
7906336 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #61
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 183 - 267
Target Start/End: Original strand, 11067433 - 11067517
Alignment:
| Q |
183 |
tgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttatt |
267 |
Q |
| |
|
||||||||||||||| || |||||||||| || |||||||| ||||||||| ||| ||||| |||| ||||||||||||||||| |
|
|
| T |
11067433 |
tgtcccgtgagcataacttagttggtaggacagtgcattataatatgcaggagccgaggttcgaaccgcggacaccccacttatt |
11067517 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #62
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 187 - 270
Target Start/End: Original strand, 12553191 - 12553275
Alignment:
| Q |
187 |
ccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccgggg-ttctaaccccggacaccccacttattcac |
270 |
Q |
| |
|
||||||||| | ||||||||||||| ||||||| |||||||||||| |||||| ||| ||||||||||||||||||||||||| |
|
|
| T |
12553191 |
ccgtgagcacagctcagttggtaggaacatgcattgttatatgcaggggccgggggttcgaaccccggacaccccacttattcac |
12553275 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #63
Raw Score: 45; E-Value: 1e-16
Query Start/End: Original strand, 186 - 281
Target Start/End: Original strand, 35111646 - 35111741
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataagtga |
281 |
Q |
| |
|
|||||||||||| |||||||| |||| |||||||||||||||||||||| | ||||||| |||||| ||||||||||||||||| ||| |||||| |
|
|
| T |
35111646 |
cccgtgagcatagctcagttgataggaacaatgcattattatatgcaggggc-ggggttcgaacccctaacaccccacttattcactttaaaagtga |
35111741 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #64
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 200 - 279
Target Start/End: Original strand, 15051558 - 15051637
Alignment:
| Q |
200 |
tcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataagt |
279 |
Q |
| |
|
||||||||||| ||||||||||||||||||| || ||||||| ||| | |||||||||||||||||||||||||||| |
|
|
| T |
15051558 |
tcagttggtagaacaatgcattattatatgcaagggtcggggtttaaactctggacaccccacttattcaccttataagt |
15051637 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #65
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 186 - 273
Target Start/End: Original strand, 18179325 - 18179412
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
|||||||||||| ||||||||| |||| ||||||| ||||||||||||||||| |||| |||||| ||||||| ||||||| |||| |
|
|
| T |
18179325 |
cccgtgagcataactcagttggcagggacatgcattgttatatgcagggaccggagttcgaaccccagacaccctgcttattctcctt |
18179412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #66
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 183 - 278
Target Start/End: Original strand, 39434612 - 39434707
Alignment:
| Q |
183 |
tgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||| |||||||| |||||||||| | ||||||||| ||||||| ||| ||| |||| |||| |||||||||||||||||||||||||||| |
|
|
| T |
39434612 |
tgtcccatgagcatagttcagttggtatgacaatgcattgttatatgtaggagccgatgttcgaacctcggacaccccacttattcaccttataag |
39434707 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #67
Raw Score: 44; E-Value: 4e-16
Query Start/End: Original strand, 186 - 273
Target Start/End: Complemental strand, 48260287 - 48260200
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
|||||||||||| ||||||||| |||| |||||||||||||| ||| ||| |||| |||||||||||||||||||||||||||| |
|
|
| T |
48260287 |
cccgtgagcatagctcagttggcagggatgtgcattattatatgtcggggtcggagttcgaaccccggacaccccacttattcacctt |
48260200 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #68
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 188 - 278
Target Start/End: Complemental strand, 8364504 - 8364414
Alignment:
| Q |
188 |
cgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||| ||||||||||||| |||||||||||||||| | || ||| |||| ||||||| || ||||||||||||||||| |||| |
|
|
| T |
8364504 |
cgtgagcataactcagttggtaggaaaatgcattattatatgtatgggtcggagttcgaaccccgaacgccccacttattcaccttttaag |
8364414 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #69
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 192 - 278
Target Start/End: Complemental strand, 11802112 - 11802026
Alignment:
| Q |
192 |
agcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||| ||||||||||||| ||||||||||||||||| |||| ||||||| |||||||||||| || |||||||| ||||||| |
|
|
| T |
11802112 |
agcataactcagttggtaggacaatgcattattatatgtaggggttggggttcgaaccccggacacttcatttattcacgttataag |
11802026 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #70
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 187 - 277
Target Start/End: Original strand, 38851633 - 38851723
Alignment:
| Q |
187 |
ccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataa |
277 |
Q |
| |
|
||||||| ||| ||||||||||||| ||||||||||||||||| ||| |||||||| || ||| |||||| ||||| |||||||||||| |
|
|
| T |
38851633 |
ccgtgagaatagctcagttggtaggacaatgcattattatatgtaggtgtcggggttcaaatcccagacacctcacttgttcaccttataa |
38851723 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #71
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 191 - 276
Target Start/End: Original strand, 44341286 - 44341369
Alignment:
| Q |
191 |
gagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttata |
276 |
Q |
| |
|
||||||| ||||||||||||| |||| |||||||||| | ||| ||||||||| ||| | ||||||||||||||||||||||||| |
|
|
| T |
44341286 |
gagcatagctcagttggtaggacaatacattattataagtagg--ccggggttcaaactctggacaccccacttattcaccttata |
44341369 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #72
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 184 - 278
Target Start/End: Original strand, 49916435 - 49916529
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||||||| ||| |||||||| ||||||||||||||||| |||| |||||||| || |||||||| |||| ||||||| ||||||| |
|
|
| T |
49916435 |
gtcccgtgagcatagatcaattggtaggacaatgcattattatatgtaggggtcggggttcgaatcccggacatcccatttattcatattataag |
49916529 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #73
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 188 - 269
Target Start/End: Complemental strand, 11238124 - 11238043
Alignment:
| Q |
188 |
cgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattca |
269 |
Q |
| |
|
|||||||||| ||||| ||| | || |||||||||||||||||||| |||||||| || ||||||||||||||||||||| |
|
|
| T |
11238124 |
cgtgagcatagctcagatggcatggacatgcattattatatgcaggggtcggggttcgaatcccggacaccccacttattca |
11238043 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #74
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 192 - 269
Target Start/End: Original strand, 16182812 - 16182889
Alignment:
| Q |
192 |
agcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattca |
269 |
Q |
| |
|
|||||| ||||||||| || | ||||||||||||||| |||| | ||||||| |||||||||||||||||||||||| |
|
|
| T |
16182812 |
agcatagctcagttggcagagacatgcattattatatgtaggggctggggttcaaaccccggacaccccacttattca |
16182889 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #75
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 191 - 275
Target Start/End: Complemental strand, 47939292 - 47939208
Alignment:
| Q |
191 |
gagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttat |
275 |
Q |
| |
|
||||||| ||||||||| |||| ||||||||| |||||||||||| ||||||| ||| |||||||||||||||||||||||||| |
|
|
| T |
47939292 |
gagcatagctcagttggcagggacaatgcattgttatatgcagggtt-ggggttcgaactccggacaccccacttattcaccttat |
47939208 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #76
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 213 - 274
Target Start/End: Complemental strand, 50859438 - 50859377
Alignment:
| Q |
213 |
caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctta |
274 |
Q |
| |
|
||||||||| ||||||||||| ||||||||| ||||||||||||||||| ||||||||||| |
|
|
| T |
50859438 |
caatgcattgatatatgcaggggccggggttcaaaccccggacaccccacatattcacctta |
50859377 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #77
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 186 - 274
Target Start/End: Complemental strand, 2643913 - 2643825
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctta |
274 |
Q |
| |
|
|||||||||||| || |||||| || | ||||||||||||||||| || ||||||| |||||| |||||||||||||||||||||| |
|
|
| T |
2643913 |
cccgtgagcatagcttagttggcagagacatgcattattatatgcatgggtcggggtttgaaccccagacaccccacttattcacctta |
2643825 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #78
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 182 - 262
Target Start/End: Complemental strand, 11907404 - 11907324
Alignment:
| Q |
182 |
atgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccac |
262 |
Q |
| |
|
|||||||||||||||| || | || || || |||||||||||||||||||| | ||||||||| ||||||| ||||||||| |
|
|
| T |
11907404 |
atgtcccgtgagcataacttaattagttggacaatgcattattatatgcagaggccggggttcgaaccccgaacaccccac |
11907324 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #79
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 194 - 269
Target Start/End: Complemental strand, 17871169 - 17871096
Alignment:
| Q |
194 |
catacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattca |
269 |
Q |
| |
|
|||| |||||||| |||| |||||||||||||||||||||| |||||||| ||||||| |||||| ||||||||| |
|
|
| T |
17871169 |
catagctcagttgataggacaatgcattattatatgcaggg--cggggttcgaaccccgaacaccctacttattca |
17871096 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #80
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 221 - 273
Target Start/End: Original strand, 19424078 - 19424130
Alignment:
| Q |
221 |
tattatatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
|||||||||||||| |||||||| |||||||||||||||||||||||||||| |
|
|
| T |
19424078 |
tattatatgcaggggtcggggttcgaaccccggacaccccacttattcacctt |
19424130 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #81
Raw Score: 41; E-Value: 0.00000000000003
Query Start/End: Original strand, 189 - 273
Target Start/End: Original strand, 43020611 - 43020695
Alignment:
| Q |
189 |
gtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
||||||||| ||| ||||| |||| |||||||||||||||||||| ||||||| |||| ||||||||||||| ||||||||| |
|
|
| T |
43020611 |
gtgagcatagctcggttggcagggacatgcattattatatgcaggggttggggttcgaacctcggacaccccactcattcacctt |
43020695 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #82
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 202 - 273
Target Start/End: Complemental strand, 1576203 - 1576132
Alignment:
| Q |
202 |
agttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
|||||| |||| |||| ||||||||||||||| ||||| ||| |||||||||||||||||||||| ||||| |
|
|
| T |
1576203 |
agttggcagggatatgctttattatatgcaggggccgggattcaaaccccggacaccccacttatttacctt |
1576132 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #83
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 199 - 270
Target Start/End: Complemental strand, 2208723 - 2208652
Alignment:
| Q |
199 |
ctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcac |
270 |
Q |
| |
|
|||| |||||||| |||||||||||||||||||||| || ||||| |||||| |||| ||||||||||||| |
|
|
| T |
2208723 |
ctcaattggtaggacaatgcattattatatgcaggggacgaggttcaaaccccagacatcccacttattcac |
2208652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #84
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 183 - 234
Target Start/End: Complemental strand, 5172703 - 5172652
Alignment:
| Q |
183 |
tgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcaggg |
234 |
Q |
| |
|
||||||||||||||| |||||||| |||| |||||||||||||||||||||| |
|
|
| T |
5172703 |
tgtcccgtgagcatagctcagttgataggacaatgcattattatatgcaggg |
5172652 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #85
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 199 - 281
Target Start/End: Complemental strand, 17954945 - 17954862
Alignment:
| Q |
199 |
ctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataagtga |
281 |
Q |
| |
|
||||||||| |||| ||||||||| ||||||||||||| || ||||| || ||||||||||||||||||||| ||| |||||| |
|
|
| T |
17954945 |
ctcagttggcagggacaatgcattgttatatgcagggatcgtggttcgaataccggacaccccacttattcactttaaaagtga |
17954862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #86
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 186 - 264
Target Start/End: Original strand, 21265656 - 21265734
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaat-gcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||||||| || |||||||||||||| || |||| ||||||||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
21265656 |
cccgtgagcttagctcagttggtagggatattgcat-attatatgcaggggccggggttcgaaccccggacaccccactt |
21265734 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #87
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 187 - 278
Target Start/End: Original strand, 22346418 - 22346508
Alignment:
| Q |
187 |
ccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||||| || |||||||||| |||| |||||||||| |||||| | |||||| ||||| | |||||||| |||||||||||||||| |
|
|
| T |
22346418 |
ccgtgagcatagctaagttggtaggacaatacattattataagcaggggtc-gggttcgaaccctgaacaccccatttattcaccttataag |
22346508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #88
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 186 - 264
Target Start/End: Original strand, 33207205 - 33207283
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaat-gcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||||||| || |||||||||||||| || |||| ||||||||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
33207205 |
cccgtgagcttagctcagttggtagggatattgcat-attatatgcaggggccggggttcgaaccccggacaccccactt |
33207283 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #89
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 183 - 278
Target Start/End: Complemental strand, 34560438 - 34560344
Alignment:
| Q |
183 |
tgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||||| || ||||||||||||| |||||||||||||||| | || | || ||| |||| |||||||||||||||||||||||||||| |
|
|
| T |
34560438 |
tgtcccgtgagtttagctcagttggtaggataatgcattattatatgtatgggtcagg-ttcgaacctcggacaccccacttattcaccttataag |
34560344 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #90
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 186 - 264
Target Start/End: Complemental strand, 36666646 - 36666568
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||||||| || |||||||||||||| || ||||| ||| ||||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
36666646 |
cccgtgagcttagctcagttggtagggacattgcataatt-tatgcaggggccggggttcgaaccccggacaccccactt |
36666568 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #91
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 186 - 273
Target Start/End: Original strand, 41677057 - 41677144
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
||||||||| || ||||||||| || | || ||||||||||||| ||| |||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
41677057 |
cccgtgagcgtagctcagttggcagagacattcattattatatgcgggggtcggggttcgaactccggacaccccacttattcacctt |
41677144 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #92
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 184 - 267
Target Start/End: Original strand, 43092148 - 43092231
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttatt |
267 |
Q |
| |
|
||||| |||||||| |||| |||||||| ||| ||||||||||||||||| |||||||| |||| ||||||||| ||||||| |
|
|
| T |
43092148 |
gtcccatgagcataactcaattggtaggataatacattattatatgcaggggtcggggttcgaacctcggacacccaacttatt |
43092231 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #93
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 215 - 273
Target Start/End: Original strand, 31965538 - 31965596
Alignment:
| Q |
215 |
atgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
||||||||||||||||||||| |||||||| ||| ||| ||||| |||||||||||||| |
|
|
| T |
31965538 |
atgcattattatatgcagggatcggggttcgaactccgaacacctcacttattcacctt |
31965596 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #94
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 184 - 278
Target Start/End: Complemental strand, 33059592 - 33059499
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||| |||| |||| ||||||||||||| |||||||||||||||||| | |||| |||| || |||||||||| |||||||||||||||||| |
|
|
| T |
33059592 |
gtcctgtgaacatagctcagttggtaggataatgcattattatatgca-gaaccgaagttcgaatcccggacaccttacttattcaccttataag |
33059499 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #95
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 187 - 272
Target Start/End: Complemental strand, 41833633 - 41833547
Alignment:
| Q |
187 |
ccgtgagcatacctcagttggtagggcaatgcattattatatgcag-ggaccggggttctaaccccggacaccccacttattcacct |
272 |
Q |
| |
|
||||||||||| ||| |||||| | ||||||||||||||||| || || |||||||| ||||||| ||||||||||||||||||| |
|
|
| T |
41833633 |
ccgtgagcatagttcaattggtatgacaatgcattattatatgtagagggtcggggttcgaaccccgaacaccccacttattcacct |
41833547 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #96
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 186 - 268
Target Start/End: Original strand, 42908768 - 42908850
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattc |
268 |
Q |
| |
|
||||||||| || ||||||||| |||| ||||||| |||||||||||| |||||||| ||| ||||| ||||||||||||| |
|
|
| T |
42908768 |
cccgtgagcttagctcagttggcagggacatgcattgttatatgcaggggtcggggttcgaactccggataccccacttattc |
42908850 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #97
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 186 - 264
Target Start/End: Complemental strand, 18512646 - 18512567
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggc--aatgcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||||||| | |||||||||||||| |||||||| |||||||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
18512646 |
cccgtgagctttgctcagttggtagggacaaatgcatt-ttatatgcaggggccggggttcgaaccccggacaccccactt |
18512567 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #98
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 186 - 278
Target Start/End: Complemental strand, 30632483 - 30632390
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||| |||| |||||||| |||| ||||||||| |||||||||||| ||| ||||| || |||| ||||| |||||||||| |||||||| |
|
|
| T |
30632483 |
cccgtgatcatagctcagttgacagggacaatgcattgttatatgcaggggccgaggttcaaatcccgaacaccacacttattcatcttataag |
30632390 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #99
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 213 - 278
Target Start/End: Complemental strand, 39994919 - 39994854
Alignment:
| Q |
213 |
caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||| ||||||| |||| |||||||| || |||||||| ||||||||||||||||||||| |
|
|
| T |
39994919 |
caatgcattgttatatgtaggggccggggtttgaatcccggacatcccacttattcaccttataag |
39994854 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #100
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 215 - 272
Target Start/End: Complemental strand, 40454240 - 40454183
Alignment:
| Q |
215 |
atgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacct |
272 |
Q |
| |
|
||||||||||||||||| || ||||||||| ||| |||||||||| |||||||||||| |
|
|
| T |
40454240 |
atgcattattatatgcaagggccggggttcgaactccggacacccaacttattcacct |
40454183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #101
Raw Score: 38; E-Value: 0.000000000002
Query Start/End: Original strand, 221 - 274
Target Start/End: Complemental strand, 42946530 - 42946477
Alignment:
| Q |
221 |
tattatatgcagggaccggggttctaaccccggacaccccacttattcacctta |
274 |
Q |
| |
|
|||||||||||||| | |||||| ||||||||||||||||||||||||||||| |
|
|
| T |
42946530 |
tattatatgcaggggctggggtttgaaccccggacaccccacttattcacctta |
42946477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #102
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 189 - 273
Target Start/End: Original strand, 195044 - 195128
Alignment:
| Q |
189 |
gtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
|||||| || ||||||||| |||| |||||| ||||||||||||| | | ||||| ||||| ||||||||||||||||||||| |
|
|
| T |
195044 |
gtgagcgtagctcagttggcagggacatgcataattatatgcaggggctgaggttcgtaccccagacaccccacttattcacctt |
195128 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #103
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 186 - 274
Target Start/End: Original strand, 9931084 - 9931172
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctta |
274 |
Q |
| |
|
|||||||||||| ||||||| | |||| ||||||||||||||||| | | || |||| |||||| ||||||||||||||||||||| |
|
|
| T |
9931084 |
cccgtgagcataactcagttagcagggacatgcattattatatgcaagagctggagttcgaaccccaaacaccccacttattcacctta |
9931172 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #104
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 183 - 278
Target Start/End: Original strand, 12866117 - 12866213
Alignment:
| Q |
183 |
tgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcag-ggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||| ||||||||| ||| |||||||| ||||||||||||||||||| || ||||||||| || ||| |||||| ||||||||| |||||||| |
|
|
| T |
12866117 |
tgtcctgtgagcatagctcgattggtaggataatgcattattatatgcagagggccggggttcgaatcccacacaccctacttattcatcttataag |
12866213 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #105
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 194 - 278
Target Start/End: Complemental strand, 23345145 - 23345063
Alignment:
| Q |
194 |
catacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||| ||||||||||||| ||||||||| |||||||||||| || |||||| ||| || |||| |||||||||||||||||||| |
|
|
| T |
23345145 |
catagctcagttggtaggacaatgcattgttatatgcaggggcc-gggttcgaactcc-aacactccacttattcaccttataag |
23345063 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #106
Raw Score: 37; E-Value: 0.000000000007
Query Start/End: Original strand, 221 - 273
Target Start/End: Complemental strand, 35195674 - 35195622
Alignment:
| Q |
221 |
tattatatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
||||||||||||||||| |||||| ||||||| |||| ||||||||||||||| |
|
|
| T |
35195674 |
tattatatgcagggaccagggttcgaaccccgtacactccacttattcacctt |
35195622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #107
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 226 - 273
Target Start/End: Complemental strand, 2350433 - 2350386
Alignment:
| Q |
226 |
tatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
||||||||||| ||||||| ||||||| |||||||||||||||||||| |
|
|
| T |
2350433 |
tatgcagggactggggttcgaaccccgaacaccccacttattcacctt |
2350386 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #108
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 186 - 264
Target Start/End: Original strand, 22563386 - 22563464
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaat-gcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||||||| || |||||||||||||| || |||| ||||||||||||| ||||||||| |||||||||||| |||||| |
|
|
| T |
22563386 |
cccgtgagcttagctcagttggtagggatattgcat-attatatgcaggggccggggttcgaaccccggacactccactt |
22563464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #109
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 186 - 229
Target Start/End: Complemental strand, 29442065 - 29442022
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaatgcattattatatg |
229 |
Q |
| |
|
|||||||||||| ||||||||||||| ||||||||||||||||| |
|
|
| T |
29442065 |
cccgtgagcatagctcagttggtaggacaatgcattattatatg |
29442022 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #110
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 186 - 264
Target Start/End: Complemental strand, 42490480 - 42490402
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaat-gcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||||||| || |||||||||||||| || |||| ||||||||||||| |||||||| ||||||||||||||||||| |
|
|
| T |
42490480 |
cccgtgagcttagctcagttggtagggatattgcat-attatatgcaggggtcggggttcgaaccccggacaccccactt |
42490402 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #111
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 186 - 264
Target Start/End: Original strand, 44732633 - 44732711
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaat-gcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||||||| || |||||||||||||| || |||| |||||||||| || ||||||||| ||||||||||||||||||| |
|
|
| T |
44732633 |
cccgtgagcttaactcagttggtagggatattgcat-attatatgcaagggccggggttcgaaccccggacaccccactt |
44732711 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #112
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 184 - 231
Target Start/End: Complemental strand, 49010800 - 49010753
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgca |
231 |
Q |
| |
|
|||||||||||||| ||||||||||||| ||||| ||||||||||||| |
|
|
| T |
49010800 |
gtcccgtgagcatagctcagttggtaggacaatgtattattatatgca |
49010753 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #113
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 215 - 273
Target Start/End: Original strand, 1660969 - 1661027
Alignment:
| Q |
215 |
atgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
|||||||||||||||||||| ||||||||| ||||||| |||| ||||| |||| |||| |
|
|
| T |
1660969 |
atgcattattatatgcaggggccggggttcgaaccccgaacactccactcattctcctt |
1661027 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #114
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 215 - 273
Target Start/End: Complemental strand, 2903096 - 2903038
Alignment:
| Q |
215 |
atgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
||||||| |||||||||| | |||||||| ||||||| |||||||||||||||||||| |
|
|
| T |
2903096 |
atgcattgttatatgcagaggtcggggttcgaaccccgaacaccccacttattcacctt |
2903038 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #115
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 200 - 278
Target Start/End: Complemental strand, 6014600 - 6014524
Alignment:
| Q |
200 |
tcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||||| |||||||| |||||||||||||| | | ||| || ||||||||||||||||||||||||||||| |
|
|
| T |
6014600 |
tcagttggtaggacaatgcat-attatatgcagggatcaag-ttcgaattccggacaccccacttattcaccttataag |
6014524 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #116
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 191 - 269
Target Start/End: Original strand, 23750152 - 23750230
Alignment:
| Q |
191 |
gagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattca |
269 |
Q |
| |
|
||||||| |||||||||||||| ||||||| |||||| || || |||||||| ||||| | |||||||||||||||| |
|
|
| T |
23750152 |
gagcatagctcagttggtagggatatgcattgttatatacatgggtcggggttcaaaccctgaacaccccacttattca |
23750230 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #117
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 200 - 278
Target Start/End: Original strand, 24636735 - 24636813
Alignment:
| Q |
200 |
tcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||| | |||| |||||||||||| ||| |||| |||| ||| ||||||||| ||||||||||||| ||||| |
|
|
| T |
24636735 |
tcagttggtatgacaatacattattatatgtaggagccggagttcgaactccggacacctcacttattcacctgataag |
24636813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #118
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 224 - 274
Target Start/End: Original strand, 32635175 - 32635225
Alignment:
| Q |
224 |
tatatgcagggaccggggttctaaccccggacaccccacttattcacctta |
274 |
Q |
| |
|
||||||||||| ||||||| ||||||||||||||||||||||||||||| |
|
|
| T |
32635175 |
tatatgcaggggttggggttcgaaccccggacaccccacttattcacctta |
32635225 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #119
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 224 - 274
Target Start/End: Original strand, 32660865 - 32660915
Alignment:
| Q |
224 |
tatatgcagggaccggggttctaaccccggacaccccacttattcacctta |
274 |
Q |
| |
|
||||||||||| | ||||||| ||||||||||||||||||| ||||||||| |
|
|
| T |
32660865 |
tatatgcaggggctggggttcaaaccccggacaccccactttttcacctta |
32660915 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #120
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 188 - 278
Target Start/End: Original strand, 43237772 - 43237862
Alignment:
| Q |
188 |
cgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||| ||| ||||| ||||||| |||||||||||||||||||||| | | |||| |||| | ||||||||| ||||||| ||| |||| |
|
|
| T |
43237772 |
cgtgagtataactcagctggtaggacaatgcattattatatgcaggggtcagagttcgaaccacagacaccccagttattcatcttgtaag |
43237862 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #121
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 228 - 269
Target Start/End: Complemental strand, 24134680 - 24134639
Alignment:
| Q |
228 |
tgcagggaccggggttctaaccccggacaccccacttattca |
269 |
Q |
| |
|
||||||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
24134680 |
tgcaggggccggggttcgaaccccggacaccccacttattca |
24134639 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #122
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 205 - 278
Target Start/End: Original strand, 44803243 - 44803316
Alignment:
| Q |
205 |
tggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||| ||||||||||||||||| ||| | || |||| ||||||| |||||| ||||||||| |||||||| |
|
|
| T |
44803243 |
tggtaggacaatgcattattatatgttggggctggagttcgaaccccgtacaccctacttattcatcttataag |
44803316 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #123
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 226 - 274
Target Start/End: Complemental strand, 25800391 - 25800343
Alignment:
| Q |
226 |
tatgcagggaccggggttctaaccccggacaccccacttattcacctta |
274 |
Q |
| |
|
|||| |||| ||||||||| |||||||||||||||||||||||| |||| |
|
|
| T |
25800391 |
tatgtagggtccggggttccaaccccggacaccccacttattcatctta |
25800343 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #124
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 190 - 274
Target Start/End: Complemental strand, 33176197 - 33176113
Alignment:
| Q |
190 |
tgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctta |
274 |
Q |
| |
|
|||||||| |||||||||||||| ||||||| |||||||||||| | || |||| || ||| |||||| || || ||||||||| |
|
|
| T |
33176197 |
tgagcatagctcagttggtagggatatgcattgttatatgcaggggctggagttcaaatcccagacacctcatttgttcacctta |
33176113 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #125
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 186 - 274
Target Start/End: Original strand, 33694539 - 33694627
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctta |
274 |
Q |
| |
|
|||||||||||| || |||||| |||| ||||||||||||||| |||| || |||| ||| ||| |||||| |||||||||||||| |
|
|
| T |
33694539 |
cccgtgagcataacttagttggcagggatatgcattattatatgtaggggtcgaggtttgaacgccgaacacccaacttattcacctta |
33694627 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #126
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 246 - 278
Target Start/End: Original strand, 35593820 - 35593852
Alignment:
| Q |
246 |
aaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||||||||||||||||||||||||||| |
|
|
| T |
35593820 |
aaccccggacaccccacttattcaccttataag |
35593852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #127
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 187 - 274
Target Start/End: Complemental strand, 37262202 - 37262117
Alignment:
| Q |
187 |
ccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctta |
274 |
Q |
| |
|
||||||||||| |||||||| |||| |||| || |||||||||||| | || ||| ||||||||| ||||||||||||||||||| |
|
|
| T |
37262202 |
ccgtgagcatagttcagttggcagggacatgcgttgttatatgcagggtcagg--ttcaaaccccggataccccacttattcacctta |
37262117 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #128
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 218 - 270
Target Start/End: Original strand, 41182803 - 41182855
Alignment:
| Q |
218 |
cattattatatgcagggaccggggttctaaccccggacaccccacttattcac |
270 |
Q |
| |
|
|||| |||||||||||| ||||||| ||||||||||||||||||||||||| |
|
|
| T |
41182803 |
cattgttatatgcaggggtcggggtttgaaccccggacaccccacttattcac |
41182855 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #129
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 221 - 269
Target Start/End: Original strand, 42367747 - 42367795
Alignment:
| Q |
221 |
tattatatgcagggaccggggttctaaccccggacaccccacttattca |
269 |
Q |
| |
|
|||||||||||||| ||||||||| || |||||||| |||||||||||| |
|
|
| T |
42367747 |
tattatatgcaggggccggggttcgaatcccggacaacccacttattca |
42367795 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #130
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 185 - 277
Target Start/End: Original strand, 50755341 - 50755432
Alignment:
| Q |
185 |
tcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataa |
277 |
Q |
| |
|
|||||||| |||| ||||||||||| |||| |||||||||||||||| | | |||| ||||| ||||| |||||||||||||||||||| |
|
|
| T |
50755341 |
tcccgtgaacatagttcagttggtagaataatgaattattatatgcaggggctgtagttcaaaccctggaca-cccacttattcaccttataa |
50755432 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #131
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 186 - 264
Target Start/End: Complemental strand, 1570262 - 1570184
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaat-gcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||||||| || |||||||||||||| || |||| |||||||||||| ||||||||| |||||||||||| |||||| |
|
|
| T |
1570262 |
cccgtgagcttagctcagttggtagggatattgcat-attatatgcaggagccggggttcgaaccccggacactccactt |
1570184 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #132
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 186 - 264
Target Start/End: Complemental strand, 6438134 - 6438056
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaat-gcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||||||| || |||||||||||||| || |||| |||||||||||| ||||||||| |||||||||||| |||||| |
|
|
| T |
6438134 |
cccgtgagcttagctcagttggtagggatattgcat-attatatgcaggagccggggttcgaaccccggacactccactt |
6438056 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #133
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 186 - 264
Target Start/End: Complemental strand, 6893307 - 6893229
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaat-gcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||||||| || |||||||||||||| || ||||| |||||||||||| ||| ||||| |||||||||||| |||||| |
|
|
| T |
6893307 |
cccgtgagcttagctcagttggtagggatattgcatt-ttatatgcaggggccgaggttcgaaccccggacactccactt |
6893229 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #134
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 186 - 264
Target Start/End: Complemental strand, 7166297 - 7166219
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaat-gcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||||||| || |||||||||||||| || |||| ||||||||||||| | ||||||| |||||||||||| |||||| |
|
|
| T |
7166297 |
cccgtgagcttagctcagttggtagggatattgcat-attatatgcaggggctggggttcgaaccccggacactccactt |
7166219 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #135
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 221 - 264
Target Start/End: Complemental strand, 7180649 - 7180606
Alignment:
| Q |
221 |
tattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
|||||||||||||| |||| |||| ||||||||||||||||||| |
|
|
| T |
7180649 |
tattatatgcaggggccggagttcgaaccccggacaccccactt |
7180606 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #136
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 199 - 278
Target Start/End: Complemental strand, 8865262 - 8865183
Alignment:
| Q |
199 |
ctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||| |||||||| |||||||||||||||||| ||| | ||||| ||||| | |||||||||||||| | |||||||| |
|
|
| T |
8865262 |
ctcaattggtaggataatgcattattatatgcaaggattgaggttcgaacccagaacaccccacttatttatcttataag |
8865183 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #137
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 221 - 264
Target Start/End: Complemental strand, 13538481 - 13538438
Alignment:
| Q |
221 |
tattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||||||| |||||| |
|
|
| T |
13538481 |
tattatatgcaggggccggggttcgaaccccggacactccactt |
13538438 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #138
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 186 - 264
Target Start/End: Complemental strand, 15819671 - 15819593
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaat-gcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||||||| || |||||||||||||| || |||| |||||||||||| ||||||||| |||||||||||| |||||| |
|
|
| T |
15819671 |
cccgtgagcttagctcagttggtagggatattgcat-attatatgcaggagccggggttcgaaccccggacactccactt |
15819593 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #139
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 186 - 264
Target Start/End: Original strand, 16343028 - 16343106
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaat-gcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||||||| || |||||||||||||| || |||| |||||||||||| ||||||||| |||||||||||| |||||| |
|
|
| T |
16343028 |
cccgtgagcttagctcagttggtagggatattgcat-attatatgcaggagccggggttcgaaccccggacactccactt |
16343106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #140
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 186 - 264
Target Start/End: Complemental strand, 18467268 - 18467190
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaat-gcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
|||||||||||| |||||||||||||| || |||| ||||||||||||| | ||||||| |||||| ||||| |||||| |
|
|
| T |
18467268 |
cccgtgagcatagctcagttggtagggatattgcat-attatatgcaggggctggggttcgaaccccagacactccactt |
18467190 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #141
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 221 - 264
Target Start/End: Complemental strand, 19063368 - 19063325
Alignment:
| Q |
221 |
tattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
|||||||||||||| ||||||||| |||||||||||||||||| |
|
|
| T |
19063368 |
tattatatgcaggggccggggttcgtaccccggacaccccactt |
19063325 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #142
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 186 - 269
Target Start/End: Original strand, 19536714 - 19536796
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattca |
269 |
Q |
| |
|
||||| |||||| |||||||||||||| ||||||| |||||| |||| | ||||||| || |||||||| |||||||||||| |
|
|
| T |
19536714 |
cccgtaagcatagctcagttggtagggacatgcattgctatatgtaggggctggggttcgaa-cccggacatcccacttattca |
19536796 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #143
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 227 - 270
Target Start/End: Original strand, 33844655 - 33844698
Alignment:
| Q |
227 |
atgcagggaccggggttctaaccccggacaccccacttattcac |
270 |
Q |
| |
|
||||| ||| |||||||| ||||||||||||||||||||||||| |
|
|
| T |
33844655 |
atgcaaggatcggggttcgaaccccggacaccccacttattcac |
33844698 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #144
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 227 - 270
Target Start/End: Complemental strand, 33949323 - 33949280
Alignment:
| Q |
227 |
atgcagggaccggggttctaaccccggacaccccacttattcac |
270 |
Q |
| |
|
||||| ||| |||||||| ||||||||||||||||||||||||| |
|
|
| T |
33949323 |
atgcaaggatcggggttcgaaccccggacaccccacttattcac |
33949280 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #145
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 221 - 264
Target Start/End: Original strand, 35068722 - 35068765
Alignment:
| Q |
221 |
tattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||||||| |||| ||||||||| ||||||||||||||||||| |
|
|
| T |
35068722 |
tattatatggaggggccggggttcgaaccccggacaccccactt |
35068765 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #146
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 186 - 264
Target Start/End: Original strand, 46965740 - 46965818
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaat-gcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||||||| || |||||||||||||| || |||| |||||||||||| ||||||||| |||||||||||| |||||| |
|
|
| T |
46965740 |
cccgtgagcttagctcagttggtagggatattgcat-attatatgcaggagccggggttcgaaccccggacactccactt |
46965818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #147
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 186 - 264
Target Start/End: Original strand, 48638532 - 48638610
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaat-gcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||||||| || |||||||||||||| || ||||| |||||||||||| | ||||||| |||||| |||||||||||| |
|
|
| T |
48638532 |
cccgtgagcttagctcagttggtagggatattgcatt-ttatatgcaggggctggggttcgaaccccagacaccccactt |
48638610 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #148
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 199 - 274
Target Start/End: Original strand, 50575911 - 50575986
Alignment:
| Q |
199 |
ctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctta |
274 |
Q |
| |
|
||||||||| |||| ||||||| ||||||||| || | ||||||| |||| | |||||| ||||||||||||||| |
|
|
| T |
50575911 |
ctcagttggaagggacatgcattgttatatgcaagggctggggttcgaacctcagacacctcacttattcacctta |
50575986 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #149
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 186 - 264
Target Start/End: Complemental strand, 50899580 - 50899502
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaat-gcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||||||| || |||||||||||||| || |||| |||||||||||| ||||||||| |||||||||||| |||||| |
|
|
| T |
50899580 |
cccgtgagcttagctcagttggtagggatattgcat-attatatgcaggagccggggttcgaaccccggacactccactt |
50899502 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #150
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 188 - 274
Target Start/End: Original strand, 4288587 - 4288673
Alignment:
| Q |
188 |
cgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctta |
274 |
Q |
| |
|
|||||||||| |||| |||||| || || ||||||||||||||||| | | |||| |||||| |||||| || |||||||||||| |
|
|
| T |
4288587 |
cgtgagcataactcaattggtatggacatacattattatatgcaggggtcagagttcgaaccccagacacctcatttattcacctta |
4288673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #151
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 219 - 277
Target Start/End: Original strand, 4616903 - 4616961
Alignment:
| Q |
219 |
attattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataa |
277 |
Q |
| |
|
||||||||||| |||| || ||||| |||| | ||||||||||||||||||||||||| |
|
|
| T |
4616903 |
attattatatgtaggggtcgcggttcgaaccacagacaccccacttattcaccttataa |
4616961 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #152
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 184 - 278
Target Start/End: Complemental strand, 11213549 - 11213455
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||| |||| |||| ||||||||||| |||| |||||||||||| || | || |||| |||||||||||||||||||||| || ||||||| |
|
|
| T |
11213549 |
gtcctgtgaacatagctcagttggtaaaacaatacattattatatgtagaggttggagttcgaaccccggacaccccacttatttactttataag |
11213455 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #153
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 199 - 264
Target Start/End: Original strand, 11333677 - 11333742
Alignment:
| Q |
199 |
ctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
|||||||||||||| || ||||| ||| ||||||||| |||| |||| ||||||||||||||||||| |
|
|
| T |
11333677 |
ctcagttggtagggacattgcataatt-tatgcaggggccggagttcgaaccccggacaccccactt |
11333742 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #154
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 199 - 264
Target Start/End: Original strand, 11491698 - 11491763
Alignment:
| Q |
199 |
ctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
|||||||||||||| || ||||| ||| ||||||||| |||| |||| ||||||||||||||||||| |
|
|
| T |
11491698 |
ctcagttggtagggacattgcataatt-tatgcaggggccggagttcgaaccccggacaccccactt |
11491763 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #155
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 187 - 264
Target Start/End: Complemental strand, 16997328 - 16997251
Alignment:
| Q |
187 |
ccgtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
|||||||| || |||||||||||| | |||||||| ||| ||||||||| ||| ||||| ||||||||||||| ||||| |
|
|
| T |
16997328 |
ccgtgagcttagctcagttggtagagacaatgcat-attttatgcaggggccgaggttcgaaccccggacacctcactt |
16997251 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #156
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 228 - 270
Target Start/End: Complemental strand, 23368788 - 23368746
Alignment:
| Q |
228 |
tgcagggaccggggttctaaccccggacaccccacttattcac |
270 |
Q |
| |
|
||||||||||| |||| ||||||||||||||||||||||||| |
|
|
| T |
23368788 |
tgcagggaccgatgttcgaaccccggacaccccacttattcac |
23368746 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #157
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 188 - 274
Target Start/End: Complemental strand, 28917014 - 28916928
Alignment:
| Q |
188 |
cgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctta |
274 |
Q |
| |
|
||||| |||| || |||||||||| ||||||||||||||| |||| | | |||| |||||| ||||||||||||||||||||| |
|
|
| T |
28917014 |
cgtgaacatagctaagttggtaggaggatgcattattatatgtaggggctgaagttcgaaccccaaacaccccacttattcacctta |
28916928 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #158
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 227 - 273
Target Start/End: Original strand, 29332322 - 29332368
Alignment:
| Q |
227 |
atgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
||||| || |||||||| |||||||||||||||||||||||||||| |
|
|
| T |
29332322 |
atgcatgggccggggtttgaaccccggacaccccacttattcacctt |
29332368 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #159
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 187 - 264
Target Start/End: Complemental strand, 43021691 - 43021614
Alignment:
| Q |
187 |
ccgtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
|||||||| || || ||||||||||| |||||||| ||| ||||||||| |||||||| |||| |||||||||||||| |
|
|
| T |
43021691 |
ccgtgagcttagcttagttggtagggacaatgcat-attttatgcaggggtcggggttcgaacctcggacaccccactt |
43021614 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #160
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 241 - 278
Target Start/End: Original strand, 1031639 - 1031676
Alignment:
| Q |
241 |
gttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||| ||||||| ||||||||||||||||||||||||| |
|
|
| T |
1031639 |
gttcgaaccccgaacaccccacttattcaccttataag |
1031676 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #161
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 184 - 277
Target Start/End: Complemental strand, 6225714 - 6225622
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataa |
277 |
Q |
| |
|
|||||||||||| | |||||||||||| |||||||| ||||||| |||| || |||| || |||| |||||||||||||| ||||||||| |
|
|
| T |
6225714 |
gtcccgtgagcacagctcagttggtagat-aatgcattgttatatgtaggggttggagttcaaatcccgaacaccccacttatttaccttataa |
6225622 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #162
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 223 - 264
Target Start/End: Complemental strand, 6463069 - 6463028
Alignment:
| Q |
223 |
ttatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
|||||||||||| ||||||||| |||||||||||| |||||| |
|
|
| T |
6463069 |
ttatatgcaggggccggggttcgaaccccggacactccactt |
6463028 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #163
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 185 - 273
Target Start/End: Complemental strand, 7015786 - 7015697
Alignment:
| Q |
185 |
tcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccactt-attcacctt |
273 |
Q |
| |
|
||||||||||||| ||||||||| ||| ||||||| ||||||| |||| | | ||||| ||| ||| ||||||||||| ||||||||| |
|
|
| T |
7015786 |
tcccgtgagcatagctcagttggctgggacatgcattgttatatgtaggggctgaggttcgaactccgaacaccccacttaattcacctt |
7015697 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #164
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 188 - 273
Target Start/End: Original strand, 9004345 - 9004430
Alignment:
| Q |
188 |
cgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
|||||||||| ||||||||| |||| || ||| ||||||||||||| |||||| ||| ||||||| | |||||||||||||| |
|
|
| T |
9004345 |
cgtgagcatagctcagttggcagggacatatattgttatatgcagggattggggttaaaactccggacatctcacttattcacctt |
9004430 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #165
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 224 - 269
Target Start/End: Complemental strand, 14262781 - 14262736
Alignment:
| Q |
224 |
tatatgcagggaccggggttctaaccccggacaccccacttattca |
269 |
Q |
| |
|
||||||||||| |||||||| |||||||||||||| ||||||||| |
|
|
| T |
14262781 |
tatatgcaggggtcggggttcgaaccccggacaccctacttattca |
14262736 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #166
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 185 - 274
Target Start/End: Original strand, 19866471 - 19866560
Alignment:
| Q |
185 |
tcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctta |
274 |
Q |
| |
|
|||| ||| |||| |||| |||| |||| |||||||| |||||| |||| ||| ||| ||| ||||||||||||||||||||||||| |
|
|
| T |
19866471 |
tcccttgaacataactcaattggcagggacatgcattagtatatgtaggggccgaagtttaaactccggacaccccacttattcacctta |
19866560 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #167
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 228 - 269
Target Start/End: Complemental strand, 34702369 - 34702328
Alignment:
| Q |
228 |
tgcagggaccggggttctaaccccggacaccccacttattca |
269 |
Q |
| |
|
||||||| ||||||||| ||||||||||||| |||||||||| |
|
|
| T |
34702369 |
tgcaggggccggggttcgaaccccggacacctcacttattca |
34702328 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #168
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 224 - 269
Target Start/End: Original strand, 37203223 - 37203268
Alignment:
| Q |
224 |
tatatgcagggaccggggttctaaccccggacaccccacttattca |
269 |
Q |
| |
|
|||| |||||| ||||||||| |||||||||||||| ||||||||| |
|
|
| T |
37203223 |
tataagcagggtccggggttcgaaccccggacaccctacttattca |
37203268 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #169
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 188 - 264
Target Start/End: Complemental strand, 37662625 - 37662549
Alignment:
| Q |
188 |
cgtgagcatacctcagttggtagggcaat-gcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||||| || |||||||||||||| || |||| ||||||||||||| |||||| | ||||||||||||||||||| |
|
|
| T |
37662625 |
cgtgagcttagctcagttggtagggatattgcat-attatatgcaggggtcggggtacgaaccccggacaccccactt |
37662549 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #170
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 228 - 269
Target Start/End: Original strand, 50065049 - 50065090
Alignment:
| Q |
228 |
tgcagggaccggggttctaaccccggacaccccacttattca |
269 |
Q |
| |
|
||||||||||||||||| || | ||||||||||||||||||| |
|
|
| T |
50065049 |
tgcagggaccggggttcgaatctcggacaccccacttattca |
50065090 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #171
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 186 - 274
Target Start/End: Complemental strand, 4511623 - 4511535
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctta |
274 |
Q |
| |
|
||||||| |||| |||| |||| | || |||||||||||||||||||| ||| ||| || ||||||| ||||||||||||||||| |
|
|
| T |
4511623 |
cccgtgaacataactcaattggcaaggacatgcattattatatgcaggggtcggtgtttgaatcccggacgtcccacttattcacctta |
4511535 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #172
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 237 - 273
Target Start/End: Complemental strand, 9976431 - 9976395
Alignment:
| Q |
237 |
cggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
|||||||| ||| |||||||||||||||||||||||| |
|
|
| T |
9976431 |
cggggttcgaactccggacaccccacttattcacctt |
9976395 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #173
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 224 - 264
Target Start/End: Complemental strand, 10052503 - 10052463
Alignment:
| Q |
224 |
tatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||||||||| ||| ||||| ||||||||||||||||||| |
|
|
| T |
10052503 |
tatatgcaggggccgaggttcgaaccccggacaccccactt |
10052463 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #174
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 199 - 264
Target Start/End: Original strand, 13763773 - 13763839
Alignment:
| Q |
199 |
ctcagttggtagggc--aatgcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
|||||||||||||| |||||||| |||||||||||| | ||||||| ||||||||| ||||||||| |
|
|
| T |
13763773 |
ctcagttggtagggacaaatgcatt-ttatatgcaggggctggggttcgaaccccggataccccactt |
13763839 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #175
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 221 - 261
Target Start/End: Complemental strand, 23369089 - 23369049
Alignment:
| Q |
221 |
tattatatgcagggaccggggttctaaccccggacacccca |
261 |
Q |
| |
|
|||||||||||||| ||| ||||| |||||||||||||||| |
|
|
| T |
23369089 |
tattatatgcaggggccgcggttcgaaccccggacacccca |
23369049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #176
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 218 - 270
Target Start/End: Original strand, 30519412 - 30519464
Alignment:
| Q |
218 |
cattattatatgcagggaccggggttctaaccccggacaccccacttattcac |
270 |
Q |
| |
|
||||| ||||||||||| ||| |||| ||| ||||||||||||||||||||| |
|
|
| T |
30519412 |
cattaatatatgcaggggccgatgttcaaactccggacaccccacttattcac |
30519464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #177
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 221 - 261
Target Start/End: Original strand, 33033161 - 33033201
Alignment:
| Q |
221 |
tattatatgcagggaccggggttctaaccccggacacccca |
261 |
Q |
| |
|
|||||||||||||||||||||||| ||||| ||||||||| |
|
|
| T |
33033161 |
tattatatgcagggaccggggttcgaaccctagacacccca |
33033201 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #178
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 186 - 257
Target Start/End: Complemental strand, 40375385 - 40375314
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacac |
257 |
Q |
| |
|
|||||||||||| |||||||||||||| | |||| ||||||||||||| ||||||| | |||||||||||| |
|
|
| T |
40375385 |
cccgtgagcatagctcagttggtagggatattgca-tattatatgcaggagccggggtacgaaccccggacac |
40375314 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1; HSP #179
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 186 - 270
Target Start/End: Original strand, 41998095 - 41998178
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcac |
270 |
Q |
| |
|
|||||||||||| || ||||||||| | |||||||||||||| || || || | |||| |||| | |||||||||||||||||| |
|
|
| T |
41998095 |
cccgtgagcataactaagttggtagagacatgcattattatatacaagggcc-gagttcgaaccacagacaccccacttattcac |
41998178 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0308 (Bit Score: 61; Significance: 3e-26; HSPs: 1)
Name: scaffold0308
Description:
Target: scaffold0308; HSP #1
Raw Score: 61; E-Value: 3e-26
Query Start/End: Original strand, 186 - 281
Target Start/End: Original strand, 7072 - 7168
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataagtga |
281 |
Q |
| |
|
|||||||||||| |||||||| ||||| |||||||||||||||||||||| ||||||||| |||||||||||||||| |||||||| ||| |||||| |
|
|
| T |
7072 |
cccgtgagcatagctcagttgttagggacaatgcattattatatgcaggggccggggttcgaaccccggacaccccatttattcactttaaaagtga |
7168 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0039 (Bit Score: 59; Significance: 5e-25; HSPs: 1)
Name: scaffold0039
Description:
Target: scaffold0039; HSP #1
Raw Score: 59; E-Value: 5e-25
Query Start/End: Original strand, 184 - 278
Target Start/End: Original strand, 101826 - 101920
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||||||| ||||| ||||||| ||||||||||||||||||||| ||||||||| |||||| ||| ||||||||||||||||||||| |
|
|
| T |
101826 |
gtcccgtgagcatagctcagctggtaggataatgcattattatatgcaggggccggggttcgaaccccaaacatcccacttattcaccttataag |
101920 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0008 (Bit Score: 58; Significance: 2e-24; HSPs: 1)
Name: scaffold0008
Description:
Target: scaffold0008; HSP #1
Raw Score: 58; E-Value: 2e-24
Query Start/End: Original strand, 189 - 278
Target Start/End: Complemental strand, 43791 - 43703
Alignment:
| Q |
189 |
gtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||| ||||||||||||| ||||||||||||||||||| |||| ||||||| |||| || ||||||||||||||||||||||||| |
|
|
| T |
43791 |
gtgagcatagctcagttggtaggacaatgcattattatatgca-ggactggggttcgaacctcgaacaccccacttattcaccttataag |
43703 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0036 (Bit Score: 57; Significance: 8e-24; HSPs: 1)
Name: scaffold0036
Description:
Target: scaffold0036; HSP #1
Raw Score: 57; E-Value: 8e-24
Query Start/End: Original strand, 186 - 269
Target Start/End: Original strand, 25022 - 25106
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattca |
269 |
Q |
| |
|
|||||||||||| ||||||||| |||| |||||||||||||||||||||| | ||||||| |||||||||||||||||||||||| |
|
|
| T |
25022 |
cccgtgagcatagctcagttggcagggacaatgcattattatatgcaggggctggggttcgaaccccggacaccccacttattca |
25106 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1086 (Bit Score: 55; Significance: 1e-22; HSPs: 1)
Name: scaffold1086
Description:
Target: scaffold1086; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 184 - 278
Target Start/End: Original strand, 2483 - 2577
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||||||| ||||||||||||| |||||||||||||||||||| | | ||| ||||||||||||||||||||||||||||||||| |
|
|
| T |
2483 |
gtcccgtgagcataactcagttggtaggacaatgcattattatatgcagaggttgaagtttgaaccccggacaccccacttattcaccttataag |
2577 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0178 (Bit Score: 55; Significance: 1e-22; HSPs: 2)
Name: scaffold0178
Description:
Target: scaffold0178; HSP #1
Raw Score: 55; E-Value: 1e-22
Query Start/End: Original strand, 188 - 278
Target Start/End: Original strand, 4322 - 4412
Alignment:
| Q |
188 |
cgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||| |||||||| |||| |||| ||||||||||||||||| |||||||| |||||||||||| |||||||||||| ||||||| |
|
|
| T |
4322 |
cgtgagcatagctcagttgataggacaatacattattatatgcaggggtcggggttcgaaccccggacactccacttattcactttataag |
4412 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0178; HSP #2
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 202 - 280
Target Start/End: Original strand, 16078 - 16156
Alignment:
| Q |
202 |
agttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataagtg |
280 |
Q |
| |
|
||||| |||| ||||||||||||||||||||||| ||| |||| ||||||||||| || |||||||||||||||||||| |
|
|
| T |
16078 |
agttgataggacaatgcattattatatgcagggatcggagttcgaaccccggacatcctacttattcaccttataagtg |
16156 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1990 (Bit Score: 54; Significance: 5e-22; HSPs: 1)
Name: scaffold1990
Description:
Target: scaffold1990; HSP #1
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 189 - 278
Target Start/End: Original strand, 894 - 983
Alignment:
| Q |
189 |
gtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||| |||| |||||||| |||||||||||||||||||||| | ||||||| || ||| |||||||||||||||||||||||||| |
|
|
| T |
894 |
gtgagcatcgctcacttggtaggacaatgcattattatatgcaggggctggggttcgaatcccagacaccccacttattcaccttataag |
983 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0092 (Bit Score: 54; Significance: 5e-22; HSPs: 1)
Name: scaffold0092
Description:
Target: scaffold0092; HSP #1
Raw Score: 54; E-Value: 5e-22
Query Start/End: Original strand, 189 - 278
Target Start/End: Complemental strand, 47412 - 47323
Alignment:
| Q |
189 |
gtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||| |||| |||||||| |||||||||||||||||||||| | ||||||| || ||| |||||||||||||||||||||||||| |
|
|
| T |
47412 |
gtgagcatcgctcacttggtaggacaatgcattattatatgcaggggctggggttcgaatcccagacaccccacttattcaccttataag |
47323 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0809 (Bit Score: 53; Significance: 2e-21; HSPs: 1)
Name: scaffold0809
Description:
Target: scaffold0809; HSP #1
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 186 - 281
Target Start/End: Complemental strand, 4904 - 4809
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataagtga |
281 |
Q |
| |
|
|||||||||||| ||||||||| |||| |||||||||||||||||||||| | ||||||| || |||||||||||||||||||||| ||| |||||| |
|
|
| T |
4904 |
cccgtgagcatagctcagttggcagggacaatgcattattatatgcaggggc-ggggttcgaatcccggacaccccacttattcactttaaaagtga |
4809 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0119 (Bit Score: 52; Significance: 7e-21; HSPs: 1)
Name: scaffold0119
Description:
Target: scaffold0119; HSP #1
Raw Score: 52; E-Value: 7e-21
Query Start/End: Original strand, 186 - 273
Target Start/End: Original strand, 1036 - 1123
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
|||||||||||| |||||||||||||| |||||| |||||||| |||| | ||||||| |||||| ||||||||||||||||||||| |
|
|
| T |
1036 |
cccgtgagcatagctcagttggtagggacatgcataattatatgtaggggctggggttcgaaccccagacaccccacttattcacctt |
1123 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0334 (Bit Score: 51; Significance: 3e-20; HSPs: 1)
Name: scaffold0334
Description:
Target: scaffold0334; HSP #1
Raw Score: 51; E-Value: 3e-20
Query Start/End: Original strand, 191 - 277
Target Start/End: Original strand, 5306 - 5391
Alignment:
| Q |
191 |
gagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataa |
277 |
Q |
| |
|
||||||| |||| |||||||| |||||||||||||||||||||| || | |||| |||||||||||||||||||||||| ||||||| |
|
|
| T |
5306 |
gagcatagctcaattggtaggacaatgcattattatatgcaggggcc-gtgttcgaaccccggacaccccacttattcatcttataa |
5391 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0191 (Bit Score: 47; Significance: 7e-18; HSPs: 1)
Name: scaffold0191
Description:
Target: scaffold0191; HSP #1
Raw Score: 47; E-Value: 7e-18
Query Start/End: Original strand, 191 - 273
Target Start/End: Original strand, 16849 - 16930
Alignment:
| Q |
191 |
gagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
||||||| ||||||||||||| |||||||||||||||||||||| | |||||| ||||||| |||||| ||||||||||||| |
|
|
| T |
16849 |
gagcatagctcagttggtaggacaatgcattattatatgcaggggtc-gggttcgaaccccgaacaccctacttattcacctt |
16930 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0112 (Bit Score: 46; Significance: 3e-17; HSPs: 1)
Name: scaffold0112
Description:
Target: scaffold0112; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 186 - 270
Target Start/End: Complemental strand, 18030 - 17945
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcac |
270 |
Q |
| |
|
|||||||||||| |||| ||||||||| ||||||||| |||||||||||| | ||||||| |||||| ||||| |||||||||||| |
|
|
| T |
18030 |
cccgtgagcatagctcaattggtagggacaatgcattgttatatgcaggggctggggttcgaaccccagacactccacttattcac |
17945 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002 (Bit Score: 46; Significance: 3e-17; HSPs: 2)
Name: scaffold0002
Description:
Target: scaffold0002; HSP #1
Raw Score: 46; E-Value: 3e-17
Query Start/End: Original strand, 186 - 278
Target Start/End: Complemental strand, 451474 - 451381
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||||| ||||||| | | || ||||||||| ||||||| |||| ||||||||| ||| |||||||||||||||||||| |||||||| |
|
|
| T |
451474 |
cccgtgagcatagctcagttagcaaggacaatgcattgttatatgtaggggccggggttcgaactccggacaccccacttattcatcttataag |
451381 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0002; HSP #2
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 215 - 274
Target Start/End: Original strand, 440425 - 440484
Alignment:
| Q |
215 |
atgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctta |
274 |
Q |
| |
|
||||||||||||||| |||| ||||||||| | |||| ||||||||||||||||||||| |
|
|
| T |
440425 |
atgcattattatatgtaggggccggggttcgactcccgaacaccccacttattcacctta |
440484 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0219 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: scaffold0219
Description:
Target: scaffold0219; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 219 - 273
Target Start/End: Complemental strand, 6698 - 6644
Alignment:
| Q |
219 |
attattatatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
|||||||||||||||| ||||||||| |||||||||||||||| ||||||||||| |
|
|
| T |
6698 |
attattatatgcaggggccggggttcgaaccccggacaccccaattattcacctt |
6644 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0168 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: scaffold0168
Description:
Target: scaffold0168; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 186 - 268
Target Start/End: Complemental strand, 34131 - 34049
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattc |
268 |
Q |
| |
|
|||||||||||| ||||||||| |||| ||||||| |||||||||||| ||||||||| || |||||||| |||||||||| |
|
|
| T |
34131 |
cccgtgagcatagctcagttggcagggacatgcattgttatatgcaggggccggggttcgaattccggacactccacttattc |
34049 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0009 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 2)
Name: scaffold0009
Description:
Target: scaffold0009; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 184 - 278
Target Start/End: Complemental strand, 185612 - 185518
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||| ||||||||| ||||||||||||| ||| ||||||||||||||||| ||| |||| |||||| ||| |||||||||||| |||||||| |
|
|
| T |
185612 |
gtcctgtgagcatagctcagttggtaggacaaaacattattatatgcaggggccgaggtttgaaccccaaacatcccacttattcatcttataag |
185518 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0009; HSP #2
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 213 - 270
Target Start/End: Complemental strand, 108432 - 108375
Alignment:
| Q |
213 |
caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcac |
270 |
Q |
| |
|
|||||||||||||||||||||| | | ||||| ||||||||||||||||||||||||| |
|
|
| T |
108432 |
caatgcattattatatgcaggggctgaggttcaaaccccggacaccccacttattcac |
108375 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0006 (Bit Score: 43; Significance: 0.000000000000002; HSPs: 1)
Name: scaffold0006
Description:
Target: scaffold0006; HSP #1
Raw Score: 43; E-Value: 0.000000000000002
Query Start/End: Original strand, 184 - 258
Target Start/End: Original strand, 159009 - 159083
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacacc |
258 |
Q |
| |
|
||||| |||||||| ||||||||||||| |||||||||||||||||||||| ||||| ||| |||| ||||||| |
|
|
| T |
159009 |
gtcccatgagcataactcagttggtaggacaatgcattattatatgcaggggccgggtttcgaaccgtggacacc |
159083 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0118 (Bit Score: 42; Significance: 0.000000000000007; HSPs: 1)
Name: scaffold0118
Description:
Target: scaffold0118; HSP #1
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 185 - 274
Target Start/End: Complemental strand, 37427 - 37338
Alignment:
| Q |
185 |
tcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctta |
274 |
Q |
| |
|
||||||||||||| |||||||||||||| ||||||| || ||| ||||| ||| |||| || || ||||||||||||||||||||||| |
|
|
| T |
37427 |
tcccgtgagcatagctcagttggtagggacatgcattgttttatacaggggccgatgttcgaaacctggacaccccacttattcacctta |
37338 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0070 (Bit Score: 42; Significance: 0.000000000000007; HSPs: 1)
Name: scaffold0070
Description:
Target: scaffold0070; HSP #1
Raw Score: 42; E-Value: 0.000000000000007
Query Start/End: Original strand, 189 - 281
Target Start/End: Original strand, 12564 - 12657
Alignment:
| Q |
189 |
gtgagcatacctcagttggtaggg-caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataagtga |
281 |
Q |
| |
|
||||||||| ||||||||| |||| |||||||||||||||||||||| | |||||| |||| |||| |||||| |||||||| ||| |||||| |
|
|
| T |
12564 |
gtgagcatagctcagttggcagggacaatgcattattatatgcaggggtcagggttcgaacctcggataccccatttattcactttaaaagtga |
12657 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0343 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: scaffold0343
Description:
Target: scaffold0343; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 202 - 277
Target Start/End: Original strand, 8573 - 8648
Alignment:
| Q |
202 |
agttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataa |
277 |
Q |
| |
|
||||| |||| ||||||||||||||||| |||| ||||||| ||||||| |||||| ||||||||||||||||| |
|
|
| T |
8573 |
agttgataggacaatgcattattatatgtaggggttggggttcgaaccccgaacaccctacttattcaccttataa |
8648 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0088 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: scaffold0088
Description:
Target: scaffold0088; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 186 - 264
Target Start/End: Complemental strand, 10896 - 10818
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaat-gcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||||||| || |||||||||||||| || |||| ||||||||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
10896 |
cccgtgagcttagctcagttggtagggatattgcat-attatatgcaggggccggggttcgaaccccggacaccccactt |
10818 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0054 (Bit Score: 40; Significance: 0.0000000000001; HSPs: 1)
Name: scaffold0054
Description:
Target: scaffold0054; HSP #1
Raw Score: 40; E-Value: 0.0000000000001
Query Start/End: Original strand, 190 - 273
Target Start/End: Original strand, 67162 - 67245
Alignment:
| Q |
190 |
tgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcacctt |
273 |
Q |
| |
|
|||||||| ||||||||| |||| ||||||| ||||||| |||| | ||||||| ||||| |||||||||||||| ||||||| |
|
|
| T |
67162 |
tgagcatagctcagttgggagggatatgcattgttatatgtaggggctggggttcgaaccctggacaccccacttaatcacctt |
67245 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0765 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: scaffold0765
Description:
Target: scaffold0765; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 183 - 277
Target Start/End: Original strand, 738 - 832
Alignment:
| Q |
183 |
tgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataa |
277 |
Q |
| |
|
||||| || |||||| ||||||| |||| |||||||||||||||||| | | | | ||||| ||| | |||||||||||||||||||||||||| |
|
|
| T |
738 |
tgtcctgtaagcatagttcagttgataggacaatgcattattatatgcggaggctgaggttcgaactctggacaccccacttattcaccttataa |
832 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0533 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: scaffold0533
Description:
Target: scaffold0533; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 200 - 278
Target Start/End: Original strand, 9337 - 9415
Alignment:
| Q |
200 |
tcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||| ||||| ||||||||||||| |||||||| |||||||| || ||| |||| |||||||||||||||||||| |
|
|
| T |
9337 |
tcagttagtaggacaatgcattattacatgcaggggtcggggttcgaattccgaacactccacttattcaccttataag |
9415 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0062 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: scaffold0062
Description:
Target: scaffold0062; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 188 - 262
Target Start/End: Complemental strand, 7114 - 7040
Alignment:
| Q |
188 |
cgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccac |
262 |
Q |
| |
|
||||| |||| ||||| ||||||| |||||||||||||||||||||| | ||||||| ||||||| ||| ||||| |
|
|
| T |
7114 |
cgtgaacatagctcagctggtaggacaatgcattattatatgcaggggcgggggttcgaaccccgtacatcccac |
7040 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0059 (Bit Score: 39; Significance: 0.0000000000004; HSPs: 1)
Name: scaffold0059
Description:
Target: scaffold0059; HSP #1
Raw Score: 39; E-Value: 0.0000000000004
Query Start/End: Original strand, 188 - 278
Target Start/End: Complemental strand, 28716 - 28626
Alignment:
| Q |
188 |
cgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
||||||||| |||||||||||| ||||||||||||||||||| ||| |||| ||| |||| ||||||| | | ||| |||||||||||| |
|
|
| T |
28716 |
cgtgagcattgctcagttggtagaacaatgcattattatatgcatggatcgggattcgaacctcggacacactatttactcaccttataag |
28626 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0126 (Bit Score: 36; Significance: 0.00000000003; HSPs: 2)
Name: scaffold0126
Description:
Target: scaffold0126; HSP #1
Raw Score: 36; E-Value: 0.00000000003
Query Start/End: Original strand, 219 - 274
Target Start/End: Complemental strand, 22914 - 22860
Alignment:
| Q |
219 |
attattatatgcagggaccggggttctaaccccggacaccccacttattcacctta |
274 |
Q |
| |
|
|||||||||||||||| ||||| ||| ||||| ||||||||||||||||||||||| |
|
|
| T |
22914 |
attattatatgcaggggccggg-ttcgaaccctggacaccccacttattcacctta |
22860 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0126; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 186 - 261
Target Start/End: Complemental strand, 25059 - 24984
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacacccca |
261 |
Q |
| |
|
|||||||||||| ||||||||| || | ||||| | |||||||||||| ||||||||| ||||| ||||||||| |
|
|
| T |
25059 |
cccgtgagcatatctcagttggcagagacatgcaatgttatatgcaggggccggggttcaaaccctagacacccca |
24984 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0019 (Bit Score: 35; Significance: 0.0000000001; HSPs: 1)
Name: scaffold0019
Description:
Target: scaffold0019; HSP #1
Raw Score: 35; E-Value: 0.0000000001
Query Start/End: Original strand, 205 - 278
Target Start/End: Complemental strand, 37093 - 37019
Alignment:
| Q |
205 |
tggtagggcaatgcattattatatgcagggaccggggttctaaccccggaca-ccccacttattcaccttataag |
278 |
Q |
| |
|
||||||| |||||||||||||||| |||| ||||||||| ||||| |||| |||||||||||||| ||||||| |
|
|
| T |
37093 |
tggtaggacaatgcattattatatccaggatccggggttcgaacccaagacacccccacttattcacgttataag |
37019 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0001 (Bit Score: 34; Significance: 0.0000000004; HSPs: 1)
Name: scaffold0001
Description:
Target: scaffold0001; HSP #1
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 228 - 269
Target Start/End: Original strand, 419751 - 419792
Alignment:
| Q |
228 |
tgcagggaccggggttctaaccccggacaccccacttattca |
269 |
Q |
| |
|
||||||| ||||||||| |||||||||||||||||||||||| |
|
|
| T |
419751 |
tgcaggggccggggttcgaaccccggacaccccacttattca |
419792 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0690 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0690
Description:
Target: scaffold0690; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 185 - 264
Target Start/End: Original strand, 3665 - 3744
Alignment:
| Q |
185 |
tcccgtgagcatacctcagttggtagggcaat-gcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
|||||||||| || |||||||||||||| || |||| |||||||||||| ||| |||||| |||||||||||| |||||| |
|
|
| T |
3665 |
tcccgtgagcttaactcagttggtagggatattgcat-attatatgcaggaaccagggttcgaaccccggacactccactt |
3744 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0366 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0366
Description:
Target: scaffold0366; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 185 - 264
Target Start/End: Complemental strand, 931 - 852
Alignment:
| Q |
185 |
tcccgtgagcatacctcagttggtagggcaat-gcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
|||||||||| || |||||||||||||| || |||| |||||||||||| ||||||||| |||||||||||| |||||| |
|
|
| T |
931 |
tcccgtgagcttagctcagttggtagggatattgcat-attatatgcaggagccggggttcgaaccccggacactccactt |
852 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0102 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0102
Description:
Target: scaffold0102; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 213 - 281
Target Start/End: Original strand, 31185 - 31253
Alignment:
| Q |
213 |
caatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataagtga |
281 |
Q |
| |
|
||||| ||||||||||||| |||||||||||| |||||| ||||| |||||||||| ||| |||||| |
|
|
| T |
31185 |
caatgtattattatatgcatggaccggggttcgaaccccaaacaccatacttattcactttaaaagtga |
31253 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0027 (Bit Score: 33; Significance: 0.000000002; HSPs: 1)
Name: scaffold0027
Description:
Target: scaffold0027; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 182 - 278
Target Start/End: Complemental strand, 38725 - 38629
Alignment:
| Q |
182 |
atgtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||||||||||||||| |||| ||||||| |||| ||||||||||| |||| || | ||| || | ||||||||| ||||||||||||||||| |
|
|
| T |
38725 |
atgtcccgtgagcataactcaattggtagaataatgtattattatatgtaggggtcgagtttcgaatctcggacacccttcttattcaccttataag |
38629 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024 (Bit Score: 33; Significance: 0.000000002; HSPs: 2)
Name: scaffold0024
Description:
Target: scaffold0024; HSP #1
Raw Score: 33; E-Value: 0.000000002
Query Start/End: Original strand, 188 - 252
Target Start/End: Complemental strand, 41862 - 41798
Alignment:
| Q |
188 |
cgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccg |
252 |
Q |
| |
|
|||||||||| ||||||||||||| ||||| ||| |||||||||||| |||| ||| ||||||| |
|
|
| T |
41862 |
cgtgagcatagctcagttggtaggacaatggattgttatatgcaggggtcgggattcgaaccccg |
41798 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0024; HSP #2
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 186 - 264
Target Start/End: Original strand, 59783 - 59861
Alignment:
| Q |
186 |
cccgtgagcatacctcagttggtagggcaat-gcattattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||||||| || |||||||||||||| || |||| |||||||||||| ||||||||| |||||||||||| |||||| |
|
|
| T |
59783 |
cccgtgagcttagctcagttggtagggatattgcat-attatatgcaggagccggggttcgaaccccggacactccactt |
59861 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0117 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: scaffold0117
Description:
Target: scaffold0117; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 221 - 264
Target Start/End: Complemental strand, 18514 - 18471
Alignment:
| Q |
221 |
tattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
|||||||| ||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
18514 |
tattatatacaggggccggggttcgaaccccggacaccccactt |
18471 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0044 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: scaffold0044
Description:
Target: scaffold0044; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 231 - 278
Target Start/End: Original strand, 49862 - 49909
Alignment:
| Q |
231 |
agggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||| ||||||||| ||||||| |||||||||||||||| |||||||| |
|
|
| T |
49862 |
aggggccggggttcgaaccccgtacaccccacttattcaacttataag |
49909 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0043 (Bit Score: 32; Significance: 0.000000006; HSPs: 1)
Name: scaffold0043
Description:
Target: scaffold0043; HSP #1
Raw Score: 32; E-Value: 0.000000006
Query Start/End: Original strand, 221 - 264
Target Start/End: Complemental strand, 66623 - 66580
Alignment:
| Q |
221 |
tattatatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
|||||||||||||| ||||||||| ||||||||||||| ||||| |
|
|
| T |
66623 |
tattatatgcaggggccggggttcgaaccccggacacctcactt |
66580 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0519 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: scaffold0519
Description:
Target: scaffold0519; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 226 - 264
Target Start/End: Complemental strand, 2992 - 2954
Alignment:
| Q |
226 |
tatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
2992 |
tatgcaggggccggggttcgaaccccggacaccccactt |
2954 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0154 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: scaffold0154
Description:
Target: scaffold0154; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 226 - 264
Target Start/End: Complemental strand, 28851 - 28813
Alignment:
| Q |
226 |
tatgcagggaccggggttctaaccccggacaccccactt |
264 |
Q |
| |
|
||||||||| ||||||||| ||||||||||||||||||| |
|
|
| T |
28851 |
tatgcaggggccggggttcgaaccccggacaccccactt |
28813 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0021 (Bit Score: 31; Significance: 0.00000003; HSPs: 1)
Name: scaffold0021
Description:
Target: scaffold0021; HSP #1
Raw Score: 31; E-Value: 0.00000003
Query Start/End: Original strand, 184 - 278
Target Start/End: Complemental strand, 111797 - 111704
Alignment:
| Q |
184 |
gtcccgtgagcatacctcagttggtagggcaatgcattattatatgcagggaccggggttctaaccccggacaccccacttattcaccttataag |
278 |
Q |
| |
|
|||| ||||||| | |||| ||||||| |||| ||||||||||||||||| ||| ||| |||||||||||| ||| |||| ||||||||||| |
|
|
| T |
111797 |
gtcctgtgagcacagctcacttggtagaacaatacattattatatgcaggg-ttgggattcgaaccccggacactccatttatccaccttataag |
111704 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0687 (Bit Score: 30; Significance: 0.0000001; HSPs: 1)
Name: scaffold0687
Description:
Target: scaffold0687; HSP #1
Raw Score: 30; E-Value: 0.0000001
Query Start/End: Original strand, 239 - 276
Target Start/End: Original strand, 1471 - 1508
Alignment:
| Q |
239 |
gggttctaaccccggacaccccacttattcaccttata |
276 |
Q |
| |
|
|||||| |||||||||||||||||||||||| |||||| |
|
|
| T |
1471 |
gggttcaaaccccggacaccccacttattcatcttata |
1508 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold1343 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold1343
Description:
Target: scaffold1343; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 215 - 267
Target Start/End: Complemental strand, 946 - 894
Alignment:
| Q |
215 |
atgcattattatatgcagggaccggggttctaaccccggacaccccacttatt |
267 |
Q |
| |
|
||||||| |||||||||||| |||| ||| |||| ||||||||||||||||| |
|
|
| T |
946 |
atgcattgttatatgcaggggccggaattcgaacctcggacaccccacttatt |
894 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0246 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold0246
Description:
Target: scaffold0246; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 226 - 270
Target Start/End: Original strand, 24420 - 24464
Alignment:
| Q |
226 |
tatgcagggaccggggttctaaccccggacaccccacttattcac |
270 |
Q |
| |
|
||||||||| ||||||||| |||||||||||| |||||| ||||| |
|
|
| T |
24420 |
tatgcaggggccggggttcgaaccccggacactccacttcttcac |
24464 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: scaffold0010 (Bit Score: 29; Significance: 0.0000004; HSPs: 1)
Name: scaffold0010
Description:
Target: scaffold0010; HSP #1
Raw Score: 29; E-Value: 0.0000004
Query Start/End: Original strand, 226 - 266
Target Start/End: Complemental strand, 236387 - 236347
Alignment:
| Q |
226 |
tatgcagggaccggggttctaaccccggacaccccacttat |
266 |
Q |
| |
|
||||||||| |||||||| ||||||||||||||||||||| |
|
|
| T |
236387 |
tatgcaggggtcggggttcgaaccccggacaccccacttat |
236347 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University