View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21308_low_5 (Length: 333)
Name: NF21308_low_5
Description: NF21308
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21308_low_5 |
 |  |
|
Alignment Details
Target: chr3 (Bit Score: 279; Significance: 1e-156; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 279; E-Value: 1e-156
Query Start/End: Original strand, 18 - 325
Target Start/End: Complemental strand, 12692980 - 12692673
Alignment:
| Q |
18 |
cgaacaagagttgataattgccttnnnnnnntttgcttttgcttatcacccggatagaaaccgtggaaatgaagaagaagccgaaagaaaattcaagttt |
117 |
Q |
| |
|
|||||||||||||||||||||||| |||||||||||||||||||| |||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12692980 |
cgaacaagagttgataattgccttaaaaaaatttgcttttgcttatcacccagatagaaaccgtggaaatgaagaagaagccgaaagaaaattcaagttt |
12692881 |
T |
 |
| Q |
118 |
ggttacaatgcttatgaagttttaatagatcccgagaagcgtaggatctatgacgaatatggcgaggaagggcttcaatttggttggacccctccacggc |
217 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12692880 |
ggttacaatgcttatgaagttttaatagatcccgagaagcgtaggatctatgacgaatatggcgaggaagggcttcaatttggttggacccctccacggc |
12692781 |
T |
 |
| Q |
218 |
gtcagaaccattcatcatctaactcatctccatcgtctgctccttcttctcgtcagtcaaaaagcaccaattcatcatcttcgtcttcatcgtcctcctc |
317 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
12692780 |
gtcagaaccattcatcatctaactcatctccatcgtctgctccttcttctcgtcagtcaaaaagcaccaattcatcatcttcgtcttcatcgtcctcctc |
12692681 |
T |
 |
| Q |
318 |
ttcatctc |
325 |
Q |
| |
|
||| |||| |
|
|
| T |
12692680 |
ttcttctc |
12692673 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University