View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21308_low_6 (Length: 213)
Name: NF21308_low_6
Description: NF21308
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21308_low_6 |
 | |
|
Alignment Details
Target: chr3 (Bit Score: 102; Significance: 8e-51; HSPs: 1)
Name: chr3
Description:
Target: chr3; HSP #1
Raw Score: 102; E-Value: 8e-51
Query Start/End: Original strand, 87 - 192
Target Start/End: Complemental strand, 50585541 - 50585436
Alignment:
| Q |
87 |
catatttcaaaatctgaacctcgttcttaatatttctttgatgtatctgctcatatcattgggatataccttcagaaatttgatagtaaatatattatct |
186 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
50585541 |
catatttcaaaatctgaacctcgttcttaatatttctttgatttatctgctcatatcattgggatataccttcagaaatttgatagtaaatatattatct |
50585442 |
T |
|
| Q |
187 |
tttgtc |
192 |
Q |
| |
|
|||||| |
|
|
| T |
50585441 |
tttgtc |
50585436 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University