View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2130_high_5 (Length: 238)
Name: NF2130_high_5
Description: NF2130
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2130_high_5 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 176; Significance: 6e-95; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 176; E-Value: 6e-95
Query Start/End: Original strand, 17 - 237
Target Start/End: Complemental strand, 7451238 - 7451015
Alignment:
| Q |
17 |
agaccttatgtctcaccccaatcctttttatttcttttcagatacgtaggttgctcgtgagaagggtgaacaaatggaagttgaataaattatgtttgca |
116 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| | |||||||||||||||||||||| || |
|
|
| T |
7451238 |
agaccttatgtctcaccccaatcctttttatttcttttcagatacgtaggttgctcgtgagaagggtgaacagaaggaagttgaataaattatgtttaca |
7451139 |
T |
 |
| Q |
117 |
ttgtctggtactagtataatatttgtcatctgtcatttattatgtacttgctagtagtactttagtattcagttatggcgt----atgtacttgtcagta |
212 |
Q |
| |
|
||||||||||||||||||||||||||||||||||| |||||||||||||||||| |||||||||||||||||||||||||| ||| ||||||||||| |
|
|
| T |
7451138 |
ttgtctggtactagtataatatttgtcatctgtca-ttattatgtacttgctagcagtactttagtattcagttatggcgtatggatgcacttgtcagta |
7451040 |
T |
 |
| Q |
213 |
gtattttatcagatgtacgatactt |
237 |
Q |
| |
|
||||||||||| ||||||||||||| |
|
|
| T |
7451039 |
gtattttatcaaatgtacgatactt |
7451015 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr1 (Bit Score: 32; Significance: 0.000000005; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 32; E-Value: 0.000000005
Query Start/End: Original strand, 25 - 88
Target Start/End: Complemental strand, 9538763 - 9538700
Alignment:
| Q |
25 |
tgtctcaccccaatcctttttatttcttttcagatacgtaggttgctcgtgagaagggtgaaca |
88 |
Q |
| |
|
|||| ||||||||| ||||||||| ||||||||||||||||||| | |||| |||||| |||| |
|
|
| T |
9538763 |
tgtcacaccccaattctttttattctttttcagatacgtaggttgtttgtgataagggtaaaca |
9538700 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr7 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 19 - 83
Target Start/End: Original strand, 41572651 - 41572715
Alignment:
| Q |
19 |
accttatgtctcaccccaatcctttttatttcttttcagatacgtaggttgctcgtgagaagggt |
83 |
Q |
| |
|
||||||||||||| |||||||| ||| |||||||||||||| ||||||| | |||||||||| |
|
|
| T |
41572651 |
accttatgtctcatcccaatccatttattttcttttcagataaacaggttgcgcatgagaagggt |
41572715 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University