View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2130_low_1 (Length: 419)
Name: NF2130_low_1
Description: NF2130
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2130_low_1 |
 |  |
|
Alignment Details
Target: chr2 (Bit Score: 171; Significance: 1e-91; HSPs: 3)
Name: chr2
Description:
Target: chr2; HSP #1
Raw Score: 171; E-Value: 1e-91
Query Start/End: Original strand, 222 - 404
Target Start/End: Complemental strand, 16371349 - 16371167
Alignment:
| Q |
222 |
acacaatctgcataaaaaattaattaattaaccagcccctctcaaagagcattgtaatagtccccactcccccacttgcatttaactttttcttatagtt |
321 |
Q |
| |
|
||||||||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||||||||||||||||||||||||| |
|
|
| T |
16371349 |
acacaatctacataaaaaattaattaattaaccagcccctctcaaagagcattgtaatagtccccactcccccatttgcatttaactttttcttatagtt |
16371250 |
T |
 |
| Q |
322 |
tcttaaaaatttgatcaaaaatgacaaatttattttgcacgaaatgtccaaataataaaatccctattattgtatgagaaaag |
404 |
Q |
| |
|
|||| |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16371249 |
tcttgaaaatttgatcaaaaatgacaaatttattttgcacgaaatgtccaaataataaaatccctattattgtatgagaaaag |
16371167 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #2
Raw Score: 114; E-Value: 1e-57
Query Start/End: Original strand, 55 - 191
Target Start/End: Complemental strand, 16371535 - 16371399
Alignment:
| Q |
55 |
tatagggcattatacttttcatattgaagtgaatttggcattgtcgcccaaaactaaaattaaatggacttttagacctttaa-tttagtttttaccttc |
153 |
Q |
| |
|
||||||||||||||||| |||||||||||||||||||||||||||||||||||| |||||||||||||| ||||||||||||| |||||||||||||||| |
|
|
| T |
16371535 |
tatagggcattatacttctcatattgaagtgaatttggcattgtcgcccaaaacaaaaattaaatggac-tttagacctttaattttagtttttaccttc |
16371437 |
T |
 |
| Q |
154 |
aagccggcttcgagtttatagtaaaattttgtctaatt |
191 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||| |
|
|
| T |
16371436 |
aagccggcttcgagtttatagtaaaattttgtctaatt |
16371399 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr2; HSP #3
Raw Score: 50; E-Value: 2e-19
Query Start/End: Original strand, 1 - 58
Target Start/End: Complemental strand, 16371620 - 16371564
Alignment:
| Q |
1 |
ttataaaatgtctatcaaatatcctttatttgctattattttttaattattgtttata |
58 |
Q |
| |
|
|||||||||||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
16371620 |
ttataaaatgtctatcaaatatcctt-atttgctattattttttaattattgtttata |
16371564 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University