View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2130_low_13 (Length: 225)
Name: NF2130_low_13
Description: NF2130
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2130_low_13 |
 | |
|
Alignment Details
Target: chr1 (Bit Score: 184; Significance: 1e-99; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 184; E-Value: 1e-99
Query Start/End: Original strand, 26 - 209
Target Start/End: Original strand, 37744189 - 37744372
Alignment:
| Q |
26 |
atacttcaacggtgatagtaaatgttcataaaatttgcttaatggttttcaccaacgcagatggtttgacataatgtctatgtattaccctaaattgcaa |
125 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37744189 |
atacttcaacggtgatagtaaatgttcataaaatttgcttaatggttttcaccaacgcagatggtttgacataatgtctatgtattaccctaaattgcaa |
37744288 |
T |
|
| Q |
126 |
gatgacagataatgtactcccaaactgaggactggaaaggatcattaataggagcaggtttggttggttgagtttatttgaatt |
209 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
37744289 |
gatgacagataatgtactcccaaactgaggactggaaaggatcattaataggagcaggtttggttggttgagtttatttgaatt |
37744372 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University