View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2130_low_4 (Length: 259)
Name: NF2130_low_4
Description: NF2130
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2130_low_4 |
 | |
|
Alignment Details
Target: chr6 (Bit Score: 75; Significance: 1e-34; HSPs: 6)
Name: chr6
Description:
Target: chr6; HSP #1
Raw Score: 75; E-Value: 1e-34
Query Start/End: Original strand, 43 - 204
Target Start/End: Original strand, 12056166 - 12056318
Alignment:
| Q |
43 |
tagaacacaatctaaaaatgtcaaggtttcacgctcagagggcaatagaacacattctaaaaatggtcaccctcaaaattcatcaccatgactttgcttt |
142 |
Q |
| |
|
||||||||| ||||||||||| | | |||||| ||| |||||||||||||| ||||||||||||| |||||||||||||||||||||| | |||||| |
|
|
| T |
12056166 |
tagaacacattctaaaaatgttatg-tttcacattcattgggcaatagaacac--tctaaaaatggtctccctcaaaattcatcaccatgattctgcttt |
12056262 |
T |
|
| Q |
143 |
attgaaacatatataagagattgttctactatatctttctcccaacattaagcttgatgatg |
204 |
Q |
| |
|
|||||||| ||||||||||||||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
12056263 |
attgaaac----ataagagattgttctac--tatctttctcccaacattaagcttgatgatg |
12056318 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #2
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 43 - 107
Target Start/End: Original strand, 12056121 - 12056185
Alignment:
| Q |
43 |
tagaacacaatctaaaaatgtcaaggtttcacgctcagagggcaatagaacacattctaaaaatg |
107 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| | ||||||||||||||||||||||||| |
|
|
| T |
12056121 |
tagaacacaatctaaaaatgtgaaggtttcacgctcaaaaggcaatagaacacattctaaaaatg |
12056185 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #3
Raw Score: 53; E-Value: 2e-21
Query Start/End: Original strand, 43 - 107
Target Start/End: Complemental strand, 20626804 - 20626740
Alignment:
| Q |
43 |
tagaacacaatctaaaaatgtcaaggtttcacgctcagagggcaatagaacacattctaaaaatg |
107 |
Q |
| |
|
||||||||||||||||||||| ||||||||||||||| | ||||||||||||||||||||||||| |
|
|
| T |
20626804 |
tagaacacaatctaaaaatgtgaaggtttcacgctcaaaaggcaatagaacacattctaaaaatg |
20626740 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #4
Raw Score: 38; E-Value: 0.000000000001
Query Start/End: Original strand, 155 - 203
Target Start/End: Complemental strand, 20623182 - 20623136
Alignment:
| Q |
155 |
ataagagattgttctactatatctttctcccaacattaagcttgatgat |
203 |
Q |
| |
|
|||||||||||||||||||| ||||||||||||||||||||||||||| |
|
|
| T |
20623182 |
ataagagattgttctactat--ctttctcccaacattaagcttgatgat |
20623136 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #5
Raw Score: 36; E-Value: 0.00000000002
Query Start/End: Original strand, 43 - 133
Target Start/End: Complemental strand, 20626759 - 20626672
Alignment:
| Q |
43 |
tagaacacaatctaaaaatgtcaaggtttcacgctcagagggcaatagaacacattctaaaaatggtcaccctcaaaattcatcaccatga |
133 |
Q |
| |
|
||||||||| ||||||||||| | | |||||| ||| |||||| ||| |||| ||||||||||||| |||||||||||||||||||||| |
|
|
| T |
20626759 |
tagaacacattctaaaaatgttatg-tttcacattcatagggcagtaggacac--tctaaaaatggtctccctcaaaattcatcaccatga |
20626672 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr6; HSP #6
Raw Score: 34; E-Value: 0.0000000004
Query Start/End: Original strand, 1 - 38
Target Start/End: Complemental strand, 20597962 - 20597925
Alignment:
| Q |
1 |
ttgcttgtagaatacaaagatccaaaatatattctcaa |
38 |
Q |
| |
|
|||||| ||||||||||||||||||||||||||||||| |
|
|
| T |
20597962 |
ttgcttttagaatacaaagatccaaaatatattctcaa |
20597925 |
T |
|
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University