View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF2130_low_7 (Length: 250)
Name: NF2130_low_7
Description: NF2130
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF2130_low_7 |
 |  |
|
Alignment Details
Target: chr4 (Bit Score: 181; Significance: 7e-98; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 181; E-Value: 7e-98
Query Start/End: Original strand, 1 - 238
Target Start/End: Complemental strand, 7451009 - 7450777
Alignment:
| Q |
1 |
cgttgtactctattaagacaaatttgtatgttgtagttttaatgtatcgagtactaagattaattgggatttgggggttttgttttatgaatgggggaaa |
100 |
Q |
| |
|
|||||||||||||||||| ||||||||||||| |||||||||||||| |||||||||| || |||||||||||||||||||||||||||||||||||||| |
|
|
| T |
7451009 |
cgttgtactctattaagaaaaatttgtatgttttagttttaatgtat-gagtactaagtttgattgggatttgggggttttgttttatgaatgggggaaa |
7450911 |
T |
 |
| Q |
101 |
tcatgaatcatgcatagagttttaggtatttgatgttatgcatgttgaattgatgtatgctgcataatgaagttaagtatctttttgtaatatttatgaa |
200 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| ||| | ||||||||||||| |
|
|
| T |
7450910 |
tcatgaatcatgcatagagttttaggtatttgatgttatgcatgttgaattgatgtatgctgcataatgaagttaagtatttttctctaatatttatgaa |
7450811 |
T |
 |
| Q |
201 |
tgattgtttaggattcgtattgcatgatctatgatttt |
238 |
Q |
| |
|
|||| |||||||||| ||||||||||||||||||| |
|
|
| T |
7450810 |
tgatcgtttaggatt----ttgcatgatctatgatttt |
7450777 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University