View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21310_low_6 (Length: 234)
Name: NF21310_low_6
Description: NF21310
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21310_low_6 |
 |  |
|
Alignment Details
Target: chr1 (Bit Score: 160; Significance: 2e-85; HSPs: 1)
Name: chr1
Description:
Target: chr1; HSP #1
Raw Score: 160; E-Value: 2e-85
Query Start/End: Original strand, 54 - 213
Target Start/End: Original strand, 45868318 - 45868477
Alignment:
| Q |
54 |
ccacttttaaaattcatttagtttatataacaacatactcgacactagatataattacttctcttgcaatcaaaagtctatcaatatcatcttctaatag |
153 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45868318 |
ccacttttaaaattcatttagtttatataacaacatactcgacactagatataattacttctcttgcaatcaaaagtctatcaatatcatcttctaatag |
45868417 |
T |
 |
| Q |
154 |
atcctaaatgacatgtaggttaattacttttttgtacaataatttaacagatccgaaggt |
213 |
Q |
| |
|
|||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
45868418 |
atcctaaatgacatgtaggttaattacttttttgtacaataatttaacagatccgaaggt |
45868477 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University