View Alignment

This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.

Legend
 Query
 Query hiting target  Query hiting target's complemental strand
 Query's complemental strand hiting target  Query's complemental strand hiting target's complemental strand

Alignment Overview

Query: NF21310_low_8 (Length: 217)

Name: NF21310_low_8
Description: NF21310
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)


[»] NF21310_low_8
NF21310_low_8
[»] chr7 (1 HSPs)
chr7 (83-145)||(38913874-38913936)
[»] chr4 (1 HSPs)
chr4 (1-61)||(41705216-41705276)


Alignment Details
Target: chr7 (Bit Score: 63; Significance: 1e-27; HSPs: 1)
Name: chr7
Description:

Target: chr7; HSP #1
Raw Score: 63; E-Value: 1e-27
Query Start/End: Original strand, 83 - 145
Target Start/End: Original strand, 38913874 - 38913936
Alignment:
83 ggatcttagataatgtgaattaattaaaaataactgaagataatgaatagacatgggaagaag 145  Q
    |||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||    
38913874 ggatcttagataatgtgaattaattaaaaataactgaagataatgaatagacatgggaagaag 38913936  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]

Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:

Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 61
Target Start/End: Complemental strand, 41705276 - 41705216
Alignment:
1 atgtgaaatgaagggtttgatgattcggtgaaataacatgggaaaagccatttggttaaac 61  Q
    ||||||||||||| || ||||||   || ||||||||| |||| |||||||||||||||||    
41705276 atgtgaaatgaagagtgtgatgaggaggagaaataacaggggagaagccatttggttaaac 41705216  T

Back To: [ HSP Overview ] [ Target Overview ] [ Alignment Overview ]



© Oklahoma State University