View Alignment
This page shows all the targets hit by the same query that passed the project filter. Click a track to view the detailed alignment.
| Legend |
| | Query |
| | Query hiting target |
| Query hiting target's complemental strand |
| | Query's complemental strand hiting target |
| Query's complemental strand hiting target's complemental strand |
|
Alignment Overview
Query: NF21310_low_8 (Length: 217)
Name: NF21310_low_8
Description: NF21310
Algorithm: BLASTN 2.2.26 [Sep-21-2011]
Database: JCVI.Medtr.v4.20130313.fasta (1949 entries, 411831487 letters)
| [»] NF21310_low_8 |
 |  |
|
Alignment Details
Target: chr7 (Bit Score: 63; Significance: 1e-27; HSPs: 1)
Name: chr7
Description:
Target: chr7; HSP #1
Raw Score: 63; E-Value: 1e-27
Query Start/End: Original strand, 83 - 145
Target Start/End: Original strand, 38913874 - 38913936
Alignment:
| Q |
83 |
ggatcttagataatgtgaattaattaaaaataactgaagataatgaatagacatgggaagaag |
145 |
Q |
| |
|
||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||||| |
|
|
| T |
38913874 |
ggatcttagataatgtgaattaattaaaaataactgaagataatgaatagacatgggaagaag |
38913936 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
Target: chr4 (Bit Score: 29; Significance: 0.0000003; HSPs: 1)
Name: chr4
Description:
Target: chr4; HSP #1
Raw Score: 29; E-Value: 0.0000003
Query Start/End: Original strand, 1 - 61
Target Start/End: Complemental strand, 41705276 - 41705216
Alignment:
| Q |
1 |
atgtgaaatgaagggtttgatgattcggtgaaataacatgggaaaagccatttggttaaac |
61 |
Q |
| |
|
||||||||||||| || |||||| || ||||||||| |||| ||||||||||||||||| |
|
|
| T |
41705276 |
atgtgaaatgaagagtgtgatgaggaggagaaataacaggggagaagccatttggttaaac |
41705216 |
T |
 |
Back To:
[ HSP Overview ] [ Target Overview ] [ Alignment Overview ]
© Oklahoma State University